MEPE Rabbit Polyclonal Antibody

MEPE Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

MEPE Polyclonal Antibody
ABP59263-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MEPE protein at amino acid sequence of 20-100
  • Applications tips:
Description: A polyclonal antibody for detection of MEPE from Human. This MEPE antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MEPE protein at amino acid sequence of 20-100

MEPE Polyclonal Antibody
ABP59263-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MEPE protein at amino acid sequence of 20-100
  • Applications tips:
Description: A polyclonal antibody for detection of MEPE from Human. This MEPE antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MEPE protein at amino acid sequence of 20-100

MEPE Polyclonal Antibody
ABP59263-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MEPE protein at amino acid sequence of 20-100
  • Applications tips:
Description: A polyclonal antibody for detection of MEPE from Human. This MEPE antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MEPE protein at amino acid sequence of 20-100

Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
DLR-MEPE-Hu-48T 48T
EUR 498
  • Should the Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from serum, plasma or other biological fluids.

Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
DLR-MEPE-Hu-96T 96T
EUR 647
  • Should the Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from serum, plasma or other biological fluids.

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
DLR-MEPE-Mu-48T 48T
EUR 508
  • Should the Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from serum, plasma or other biological fluids.

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
DLR-MEPE-Mu-96T 96T
EUR 661
  • Should the Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from serum, plasma or other biological fluids.

Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
DLR-MEPE-Ra-48T 48T
EUR 528
  • Should the Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from serum, plasma or other biological fluids.

Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
DLR-MEPE-Ra-96T 96T
EUR 690
  • Should the Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from serum, plasma or other biological fluids.

Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RD-MEPE-Hu-48Tests 48 Tests
EUR 500

Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RD-MEPE-Hu-96Tests 96 Tests
EUR 692

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RD-MEPE-Mu-48Tests 48 Tests
EUR 511

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RD-MEPE-Mu-96Tests 96 Tests
EUR 709

Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RD-MEPE-Ra-48Tests 48 Tests
EUR 534

Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RD-MEPE-Ra-96Tests 96 Tests
EUR 742

Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RDR-MEPE-Hu-48Tests 48 Tests
EUR 522

Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RDR-MEPE-Hu-96Tests 96 Tests
EUR 724

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RDR-MEPE-Mu-48Tests 48 Tests
EUR 534

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RDR-MEPE-Mu-96Tests 96 Tests
EUR 742

Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RDR-MEPE-Ra-48Tests 48 Tests
EUR 558

Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RDR-MEPE-Ra-96Tests 96 Tests
EUR 776

MEPE antibody
70R-8188 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MEPE antibody

MEPE antibody
70R-18478 50 ul
EUR 435
Description: Rabbit polyclonal MEPE antibody

MEPE Antibody
1-CSB-PA013704GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MEPE. Recognizes MEPE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Rabbit MEPE ELISA Kit
ERTM0266 96Tests
EUR 521

anti- MEPE antibody
FNab05128 100µg
EUR 585
  • Immunogen: matrix extracellular phosphoglycoprotein
  • Uniprot ID: Q9NQ76
  • Gene ID: 56955
  • Research Area: Stem Cells, Cardiovascular
Description: Antibody raised against MEPE

anti- MEPE antibody
FNab05129 100µg
EUR 585
  • Immunogen: matrix extracellular phosphoglycoprotein
  • Uniprot ID: Q9NQ76
  • Gene ID: 56955
  • Research Area: Stem Cells, Cardiovascular
Description: Antibody raised against MEPE

Anti-MEPE antibody
PAab05128 100 ug
EUR 412

Anti-MEPE antibody
PAab05129 100 ug
EUR 412

Anti-MEPE antibody
STJ192466 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MEPE

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human)
4-PAB232Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Ser212~Asn445)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE)

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat)
4-PAB232Ra01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Gly28~Ser224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE)

MEPE siRNA
20-abx923938
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human), APC
4-PAB232Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Ser212~Asn445)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with APC.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human), Biotinylated
4-PAB232Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Ser212~Asn445)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with Biotin.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human), Cy3
4-PAB232Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Ser212~Asn445)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with Cy3.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human), FITC
4-PAB232Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Ser212~Asn445)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with FITC.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human), HRP
4-PAB232Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Ser212~Asn445)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with HRP.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human), PE
4-PAB232Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Ser212~Asn445)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with PE.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat), APC
4-PAB232Ra01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Gly28~Ser224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with APC.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat), Biotinylated
4-PAB232Ra01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Gly28~Ser224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with Biotin.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat), Cy3
4-PAB232Ra01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Gly28~Ser224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with Cy3.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat), FITC
4-PAB232Ra01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Gly28~Ser224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with FITC.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat), HRP
4-PAB232Ra01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Gly28~Ser224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with HRP.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat), PE
4-PAB232Ra01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Gly28~Ser224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with PE.

Rabbit Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
abx363264-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

MEPE cloning plasmid
CSB-CL013704HU-10ug 10ug
EUR 552
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1578
  • Sequence: ATGCGAGTTTTCTGTGTGGGACTACTCCTTTTCAGTGTGACCTGGGCAGCACCAACATTTCAACCACAGACTGAGAAAACTAAGCAAAGCTGTGTGGAAGAGCAGAGGCAGGAAGAAAAAAACAAAGACAATATTGGTTTTCACCATTTGGGCAAGAGAATAAATCAAGAGCTAT
  • Show more
Description: A cloning plasmid for the MEPE gene.

MEPE Blocking Peptide
33R-5267 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MEPE antibody, catalog no. 70R-8188

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
20-abx123885
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
20-abx113618
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
20-abx104132
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
20-abx104133
  • EUR 314.00
  • EUR 133.00
  • EUR 829.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
abx026780-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
abx026780-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
20-abx173468
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
20-abx173469
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
20-abx177464
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
20-abx177465
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
abx235128-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
abx235129-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human), APC-Cy7
4-PAB232Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Ser212~Asn445)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with APC-Cy7.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat), APC-Cy7
4-PAB232Ra01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Gly28~Ser224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with APC-Cy7.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody Pair
20-abx370519
  • EUR 1790.00
  • EUR 1149.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Human MEPE ELISA Kit
EHM0266 96Tests
EUR 521

Human MEPE ELISA Kit
ELA-E1232h 96 Tests
EUR 824

Goat MEPE ELISA Kit
EGTM0266 96Tests
EUR 521

Bovine MEPE ELISA Kit
EBM0266 96Tests
EUR 521

Canine MEPE ELISA Kit
ECM0266 96Tests
EUR 521

Anserini MEPE ELISA Kit
EAM0266 96Tests
EUR 521

MEPE ELISA KIT|Human
EF004667 96 Tests
EUR 689

Porcine MEPE ELISA Kit
EPM0266 96Tests
EUR 521

Rat MEPE ELISA Kit
ERM0266 96Tests
EUR 521

Sheep MEPE ELISA Kit
ESM0266 96Tests
EUR 521

Monkey MEPE ELISA Kit
EMKM0266 96Tests
EUR 521

Mouse MEPE ELISA Kit
EMM0266 96Tests
EUR 521

Human MEPE shRNA Plasmid
20-abx961253
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MEPE Recombinant Protein (Human)
RP041302 100 ug Ask for price

MEPE Recombinant Protein (Rat)
RP211391 100 ug Ask for price

MEPE Recombinant Protein (Mouse)
RP150233 100 ug Ask for price

Guinea Pig MEPE ELISA Kit
EGM0266 96Tests
EUR 521

Mepe ORF Vector (Mouse) (pORF)
ORF050079 1.0 ug DNA
EUR 506

MEPE ORF Vector (Human) (pORF)
ORF013768 1.0 ug DNA
EUR 354

Mepe ORF Vector (Rat) (pORF)
ORF070465 1.0 ug DNA
EUR 506

Recombinant Matrix Extracellular Phosphoglycoprotein (MEPE)
4-RPB232Hu01
  • EUR 377.76
  • EUR 204.00
  • EUR 1141.60
  • EUR 447.20
  • EUR 794.40
  • EUR 316.00
  • EUR 2704.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9NQ76
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.2kDa
  • Isoelectric Point: 6.2
Description: Recombinant Human Matrix Extracellular Phosphoglycoprotein expressed in: E.coli

Recombinant Matrix Extracellular Phosphoglycoprotein (MEPE)
4-RPB232Ra01
  • EUR 519.33
  • EUR 242.00
  • EUR 1672.48
  • EUR 624.16
  • EUR 1148.32
  • EUR 410.00
  • EUR 4031.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D6C6P2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.0kDa
  • Isoelectric Point: 6.4
Description: Recombinant Rat Matrix Extracellular Phosphoglycoprotein expressed in: E.coli

pECMV-Mepe-m-FLAG Plasmid
PVT15129 2 ug
EUR 325

MEPE ELISA Kit (Rat) (OKCD00669)
OKCD00669 96 Wells
EUR 857
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.62 ng/mL

MEPE ELISA Kit (Mouse) (OKCD04240)
OKCD04240 96 Wells
EUR 818
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.22 ng/mL

MEPE ELISA Kit (Human) (OKCD07233)
OKCD07233 96 Wells
EUR 936
Description: Description of target: MEPE seems to play a role in mineralization.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.137ng/mL

MEPE ELISA Kit (Human) (OKEH04666)
OKEH04666 96 Wells
EUR 662
Description: Description of target: This gene encodes a secreted calcium-binding phosphoprotein that belongs to the small integrin-binding ligand, N-linked glycoprotein (SIBLING) family of proteins. Members of this family are components of the extracellular matrix of bone and dentin and regulate bone mineralization. Deficiency of a similar protein in mouse results in increased bone mass. Mice lacking this gene are resistant to aging-related trabecular bone loss. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.43 ng/mL

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) Protein
20-abx654281
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) Protein
20-abx654282
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Matrix Extracellular Phosphoglycoprotein (MEPE) Protein
20-abx067932
  • EUR 718.00
  • EUR 286.00
  • EUR 2249.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Matrix Extracellular Phosphoglycoprotein (MEPE) Protein
20-abx067934
  • EUR 537.00
  • EUR 244.00
  • EUR 1553.00
  • EUR 634.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

MEPE sgRNA CRISPR Lentivector set (Human)
K1291301 3 x 1.0 ug
EUR 339

Mepe sgRNA CRISPR Lentivector set (Mouse)
K4424501 3 x 1.0 ug
EUR 339

Mepe sgRNA CRISPR Lentivector set (Rat)
K7118401 3 x 1.0 ug
EUR 339

Monkey Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
abx359615-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
abx361390-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
abx364222-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
abx573663-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human MEPE/ Matrix extracellular phosphoglycoprotein ELISA Kit
E2804Hu 1 Kit
EUR 571

Human MEPE(Matrix extracellular phosphoglycoprotein) ELISA Kit
EH1407 96T
EUR 524.1
  • Detection range: 0.938-60 ng/ml
  • Uniprot ID: Q9NQ76
  • Alias: MEPE(Matrix Extracellular Phosphoglycoprotein)/OF45/Osteoregulin/extracellular phosphoglycoprotein with ASARM motif(bone)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.563 ng/ml

Human Matrix extracellular phosphoglycoprotein, MEPE ELISA KIT
ELI-04077h 96 Tests
EUR 824

Human matrix extracellular phosphoglycoprotein(MEPE)ELISA Kit
GA-E1502HM-48T 48T
EUR 289

Human matrix extracellular phosphoglycoprotein(MEPE)ELISA Kit
GA-E1502HM-96T 96T
EUR 466

Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
20-abx155813
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
20-abx154371
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
20-abx152307
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Chicken Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
abx356250-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Matrix Extracellular Phosphoglycoprotein (MEPE) CLIA Kit
20-abx492522
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) CLIA Kit
20-abx492523
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Matrix Extracellular Phosphoglycoprotein (MEPE) CLIA Kit
20-abx492524
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Matrix Extracellular Phosphoglycoprotein (MEPE) CLIA Kit
abx197266-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
abx250682-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human matrix extracellular phosphoglycoprotein,MEPE ELISA Kit
201-12-1486 96 tests
EUR 440
  • This matrix extracellular phosphoglycoprotein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

MEPE sgRNA CRISPR Lentivector (Human) (Target 1)
K1291302 1.0 ug DNA
EUR 154

MEPE sgRNA CRISPR Lentivector (Human) (Target 2)
K1291303 1.0 ug DNA
EUR 154

MEPE sgRNA CRISPR Lentivector (Human) (Target 3)
K1291304 1.0 ug DNA
EUR 154

Mepe sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4424502 1.0 ug DNA
EUR 154

Mepe sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4424503 1.0 ug DNA
EUR 154

Mepe sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4424504 1.0 ug DNA
EUR 154

Human matrix extracellular phosphoglycoprotein,MEPE ELISA Kit
CN-04327H1 96T
EUR 471

Human matrix extracellular phosphoglycoprotein,MEPE ELISA Kit
CN-04327H2 48T
EUR 322

Human matrix extracellular phosphoglycoprotein, MEPE ELISA Kit
CSB-E09173h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human matrix extracellular phosphoglycoprotein, MEPE in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human matrix extracellular phosphoglycoprotein, MEPE ELISA Kit
1-CSB-E09173h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human matrix extracellular phosphoglycoprotein, MEPE in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mepe sgRNA CRISPR Lentivector (Rat) (Target 1)
K7118402 1.0 ug DNA
EUR 154

Mepe sgRNA CRISPR Lentivector (Rat) (Target 2)
K7118403 1.0 ug DNA
EUR 154

Mepe sgRNA CRISPR Lentivector (Rat) (Target 3)
K7118404 1.0 ug DNA
EUR 154

MEPE Protein Vector (Human) (pPB-C-His)
PV055069 500 ng
EUR 481

MEPE Protein Vector (Human) (pPB-N-His)
PV055070 500 ng
EUR 481

MEPE Protein Vector (Human) (pPM-C-HA)
PV055071 500 ng
EUR 481

MEPE Protein Vector (Human) (pPM-C-His)
PV055072 500 ng
EUR 481

Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
SEB232Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
SEB232Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
SEB232Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
SEB232Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
4-SEB232Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Matrix Extracellular Phosphoglycoprotein elisa. Alternative names of the recognized antigen: OF45
  • Asarm Motif-Containing
  • Osteoblast/Osteocyte Factor 45
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
SEB232Mu-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma and other biological fluids.

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
SEB232Mu-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma and other biological fluids.

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
SEB232Mu-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma and other biological fluids.

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
SEB232Mu-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma and other biological fluids.

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
4-SEB232Mu
  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Matrix Extracellular Phosphoglycoprotein elisa. Alternative names of the recognized antigen: OF45
  • Asarm Motif-Containing
  • Osteoblast/Osteocyte Factor 45
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
SEB232Ra-10x96wellstestplate 10x96-wells test plate
EUR 4875.49
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
SEB232Ra-1x48wellstestplate 1x48-wells test plate
EUR 489.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
SEB232Ra-1x96wellstestplate 1x96-wells test plate
EUR 655.94
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
SEB232Ra-5x96wellstestplate 5x96-wells test plate
EUR 2651.73
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
4-SEB232Ra
  • EUR 4926.00
  • EUR 2602.00
  • EUR 656.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Matrix Extracellular Phosphoglycoprotein elisa. Alternative names of the recognized antigen: OF45
  • Asarm Motif-Containing
  • Osteoblast/Osteocyte Factor 45
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Matrix Extracellular Phosphoglycoprotein ELISA Kit (MEPE)
RK03810 96 Tests
EUR 521

Human matrix extracellular phosphoglycoprotein(MEPE)ELISA Kit
QY-E00952 96T
EUR 361

MEPE Protein Vector (Rat) (pPB-C-His)
PV281858 500 ng
EUR 603

MEPE Protein Vector (Rat) (pPB-N-His)
PV281859 500 ng
EUR 603

MEPE Protein Vector (Rat) (pPM-C-HA)
PV281860 500 ng
EUR 603

MEPE Protein Vector (Rat) (pPM-C-His)
PV281861 500 ng
EUR 603

MEPE Protein Vector (Mouse) (pPB-C-His)
PV200314 500 ng
EUR 603

MEPE Protein Vector (Mouse) (pPB-N-His)
PV200315 500 ng
EUR 603

MEPE Protein Vector (Mouse) (pPM-C-HA)
PV200316 500 ng
EUR 603

MEPE Rabbit Polyclonal Antibody

Apex Business WordPress Theme | Designed by Crafthemes