LY86 Rabbit Polyclonal Antibody
LY86 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
LY86 Polyclonal Antibody |
ABP59168-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human LY86 protein at amino acid sequence of 80-160
- Applications tips:
|
Description: A polyclonal antibody for detection of LY86 from Human, Mouse. This LY86 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LY86 protein at amino acid sequence of 80-160 |
LY86 Polyclonal Antibody |
30708-100ul |
SAB |
100ul |
EUR 252 |
LY86 Polyclonal Antibody |
30708-50ul |
SAB |
50ul |
EUR 187 |
LY86 Rabbit pAb |
A6185-100ul |
Abclonal |
100 ul |
EUR 308 |
LY86 Rabbit pAb |
A6185-200ul |
Abclonal |
200 ul |
EUR 459 |
LY86 Rabbit pAb |
A6185-20ul |
Abclonal |
20 ul |
EUR 183 |
LY86 Rabbit pAb |
A6185-50ul |
Abclonal |
50 ul |
EUR 223 |
LY86 Polyclonal Conjugated Antibody |
C30708 |
SAB |
100ul |
EUR 397 |
LY86 Antibody |
1-CSB-PA013252ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against LY86. Recognizes LY86 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Anti-LY86 antibody |
STJ192367 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to LY86 |
LY86 siRNA |
20-abx923154 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LY86 siRNA |
20-abx923155 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Polyclonal MD-1 / LY86 Antibody (aa112-125) |
APR02819G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MD-1 / LY86 (aa112-125). This antibody is tested and proven to work in the following applications: |
LY86 cloning plasmid |
CSB-CL013252HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 489
- Sequence: atgaagggtttcacagccactctcttcctctggactctgatttttcccagctgcagtggaggcggcggtgggaaagcctggcccacacacgtggtctgtagcgacagcggcttggaagtgctctaccagagttgcgatccattacaagattttggcttttctgttgaaaagtgttc
- Show more
|
Description: A cloning plasmid for the LY86 gene. |
Lymphocyte Antigen 86 (LY86) Antibody |
20-abx006325 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Lymphocyte Antigen 86 (LY86) Antibody |
abx028333-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Lymphocyte Antigen 86 (LY86) Antibody |
abx028333-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Lymphocyte Antigen 86 (LY86) Antibody |
20-abx320689 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Lymphocyte Antigen 86 (LY86) Antibody |
20-abx225271 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Human LY86 shRNA Plasmid |
20-abx956268 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
LY86 protein (His tag) |
80R-2922 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified recombinant LY86 protein (His tag) |
Mouse LY86 shRNA Plasmid |
20-abx971389 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
LY86 Recombinant Protein (Human) |
RP018445 |
ABM |
100 ug |
Ask for price |
LY86 Recombinant Protein (Rat) |
RP210377 |
ABM |
100 ug |
Ask for price |
LY86 Recombinant Protein (Mouse) |
RP148724 |
ABM |
100 ug |
Ask for price |
Monoclonal LY86 Antibody (monoclonal) (M01), Clone: 1H3 |
AMM03756G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human LY86 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1H3. This antibody is applicable in WB, E |
Lymphocyte Antigen 86 (LY86) Protein |
20-abx261113 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
LY86 ORF Vector (Human) (pORF) |
ORF006149 |
ABM |
1.0 ug DNA |
EUR 95 |
Ly86 ORF Vector (Mouse) (pORF) |
ORF049576 |
ABM |
1.0 ug DNA |
EUR 506 |
Ly86 ORF Vector (Rat) (pORF) |
ORF070127 |
ABM |
1.0 ug DNA |
EUR 506 |
LY86 ELISA Kit (Human) (OKCA01341) |
OKCA01341 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: May cooperate with CD180 and TLR4 to mediate the innate immune response to bacterial lipopolysaccharide (LPS) and cytokine production. Important for efficient CD180 cell surface expression.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL |
LY86 sgRNA CRISPR Lentivector set (Human) |
K1246201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ly86 sgRNA CRISPR Lentivector set (Mouse) |
K3774901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ly86 sgRNA CRISPR Lentivector set (Rat) |
K6040501 |
ABM |
3 x 1.0 ug |
EUR 339 |
LY86-AS1 ORF Vector (Human) (pORF) |
ORF023191 |
ABM |
1.0 ug DNA |
Ask for price |
Chicken Lymphocyte antigen 86, LY86 ELISA KIT |
ELI-16431c |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Lymphocyte antigen 86, Ly86 ELISA KIT |
ELI-31493m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Lymphocyte antigen 86, LY86 ELISA KIT |
ELI-39140h |
Lifescience Market |
96 Tests |
EUR 824 |
LY86 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1246202 |
ABM |
1.0 ug DNA |
EUR 154 |
LY86 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1246203 |
ABM |
1.0 ug DNA |
EUR 154 |
LY86 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1246204 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Lymphocyte antigen 86(LY86) ELISA kit |
CSB-EL013252HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Lymphocyte antigen 86 (LY86) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Lymphocyte antigen 86(LY86) ELISA kit |
1-CSB-EL013252HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Lymphocyte antigen 86(LY86) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Ly86 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3774902 |
ABM |
1.0 ug DNA |
EUR 154 |
Ly86 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3774903 |
ABM |
1.0 ug DNA |
EUR 154 |
Ly86 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3774904 |
ABM |
1.0 ug DNA |
EUR 154 |
Ly86 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6040502 |
ABM |
1.0 ug DNA |
EUR 154 |
Ly86 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6040503 |
ABM |
1.0 ug DNA |
EUR 154 |
Ly86 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6040504 |
ABM |
1.0 ug DNA |
EUR 154 |
LY86 Lymphocyte Antigen 86 Human Recombinant Protein |
PROTO95711 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: LY86 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 165 amino acids (21-162) and having a molecular mass of 18.1kDa.;LY86 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Recombinant Human LY86 Protein, His, E.coli-1mg |
QP12602-1mg |
EnQuireBio |
1mg |
EUR 2757 |
Recombinant Human LY86 Protein, His, E.coli-20ug |
QP12602-20ug |
EnQuireBio |
20ug |
EUR 201 |
Recombinant Human LY86 Protein, His, E.coli-5ug |
QP12602-5ug |
EnQuireBio |
5ug |
EUR 155 |
LY86 Protein Vector (Rat) (pPB-C-His) |
PV280506 |
ABM |
500 ng |
EUR 603 |
LY86 Rabbit Polyclonal Antibody