LY86 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

LY86 Polyclonal Antibody
ABP59168-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human LY86 protein at amino acid sequence of 80-160 Applications tips:
Description: A polyclonal antibody for detection of LY86 from Human, Mouse. This LY86 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LY86 protein at amino acid sequence of 80-160

LY86 Polyclonal Antibody
30708-100ul	SAB	100ul	EUR 252

LY86 Polyclonal Antibody
30708-50ul	SAB	50ul	EUR 187

Rabbit Anti-Mouse Ly86 Polyclonal Antibody
CPB-055RM	Creative Diagnostics	50µg	EUR 715

LY86 Rabbit pAb
A6185-100ul	Abclonal	100 ul	EUR 308

LY86 Rabbit pAb
A6185-200ul	Abclonal	200 ul	EUR 459

LY86 Rabbit pAb
A6185-20ul	Abclonal	20 ul	EUR 183

LY86 Rabbit pAb
A6185-50ul	Abclonal	50 ul	EUR 223

LY86 Polyclonal Conjugated Antibody
C30708	SAB	100ul	EUR 397

LY86 Antibody
1-CSB-PA013252ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LY86. Recognizes LY86 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Anti-LY86 antibody
STJ27946	St John's Laboratory	100 µl	EUR 277

Anti-LY86 antibody
STJ192367	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to LY86

LY86 siRNA
20-abx923154	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LY86 siRNA
20-abx923155	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Polyclonal MD-1 / LY86 Antibody (aa112-125)
APR02819G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MD-1 / LY86 (aa112-125). This antibody is tested and proven to work in the following applications:

LY86 cloning plasmid
CSB-CL013252HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 489 Sequence: atgaagggtttcacagccactctcttcctctggactctgatttttcccagctgcagtggaggcggcggtgggaaagcctggcccacacacgtggtctgtagcgacagcggcttggaagtgctctaccagagttgcgatccattacaagattttggcttttctgttgaaaagtgttc Show more
Description: A cloning plasmid for the LY86 gene.

Lymphocyte Antigen 86 (LY86) Antibody
20-abx006325	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Lymphocyte Antigen 86 (LY86) Antibody
abx028333-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Lymphocyte Antigen 86 (LY86) Antibody
abx028333-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Lymphocyte Antigen 86 (LY86) Antibody
20-abx320689	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Lymphocyte Antigen 86 (LY86) Antibody
20-abx225271	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Human LY86 shRNA Plasmid
20-abx956268	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

LY86 protein (His tag)
80R-2922	Fitzgerald	100 ug	EUR 327
Description: Purified recombinant LY86 protein (His tag)

Mouse LY86 shRNA Plasmid
20-abx971389	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

LY86 Recombinant Protein (Human)
RP018445	ABM	100 ug	Ask for price

LY86 Recombinant Protein (Rat)
RP210377	ABM	100 ug	Ask for price

pCMV-SPORT6-LY86 Plasmid
PVT16733	Lifescience Market	2 ug	EUR 325

LY86 Recombinant Protein (Mouse)
RP148724	ABM	100 ug	Ask for price

Monoclonal LY86 Antibody (monoclonal) (M01), Clone: 1H3
AMM03756G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human LY86 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1H3. This antibody is applicable in WB, E

Lymphocyte Antigen 86 (LY86) Protein
20-abx261113	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

LY86 ORF Vector (Human) (pORF)
ORF006149	ABM	1.0 ug DNA	EUR 95

Ly86 ORF Vector (Mouse) (pORF)
ORF049576	ABM	1.0 ug DNA	EUR 506

Ly86 ORF Vector (Rat) (pORF)
ORF070127	ABM	1.0 ug DNA	EUR 506

LY86 ELISA Kit (Human) (OKCA01341)
OKCA01341	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: May cooperate with CD180 and TLR4 to mediate the innate immune response to bacterial lipopolysaccharide (LPS) and cytokine production. Important for efficient CD180 cell surface expression.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL

LY86 sgRNA CRISPR Lentivector set (Human)
K1246201	ABM	3 x 1.0 ug	EUR 339

Ly86 sgRNA CRISPR Lentivector set (Mouse)
K3774901	ABM	3 x 1.0 ug	EUR 339

Ly86 sgRNA CRISPR Lentivector set (Rat)
K6040501	ABM	3 x 1.0 ug	EUR 339

LY86-AS1 ORF Vector (Human) (pORF)
ORF023191	ABM	1.0 ug DNA	Ask for price

Chicken Lymphocyte antigen 86, LY86 ELISA KIT
ELI-16431c	Lifescience Market	96 Tests	EUR 928

Mouse Lymphocyte antigen 86, Ly86 ELISA KIT
ELI-31493m	Lifescience Market	96 Tests	EUR 865

Human Lymphocyte antigen 86, LY86 ELISA KIT
ELI-39140h	Lifescience Market	96 Tests	EUR 824

LY86 sgRNA CRISPR Lentivector (Human) (Target 1)
K1246202	ABM	1.0 ug DNA	EUR 154

LY86 sgRNA CRISPR Lentivector (Human) (Target 2)
K1246203	ABM	1.0 ug DNA	EUR 154

LY86 sgRNA CRISPR Lentivector (Human) (Target 3)
K1246204	ABM	1.0 ug DNA	EUR 154

Human Lymphocyte antigen 86(LY86) ELISA kit
CSB-EL013252HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Lymphocyte antigen 86 (LY86) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Lymphocyte antigen 86(LY86) ELISA kit
1-CSB-EL013252HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Lymphocyte antigen 86(LY86) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Ly86 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3774902	ABM	1.0 ug DNA	EUR 154

Ly86 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3774903	ABM	1.0 ug DNA	EUR 154

Ly86 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3774904	ABM	1.0 ug DNA	EUR 154

Ly86 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6040502	ABM	1.0 ug DNA	EUR 154

Ly86 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6040503	ABM	1.0 ug DNA	EUR 154

Ly86 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6040504	ABM	1.0 ug DNA	EUR 154

LY86 Lymphocyte Antigen 86 Human Recombinant Protein
PROTO95711	BosterBio	Regular: 20ug	EUR 317
Description: LY86 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 165 amino acids (21-162) and having a molecular mass of 18.1kDa.;LY86 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant Human LY86 Protein, His, E.coli-1mg
QP12602-1mg	EnQuireBio	1mg	EUR 2757

Recombinant Human LY86 Protein, His, E.coli-20ug
QP12602-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human LY86 Protein, His, E.coli-5ug
QP12602-5ug	EnQuireBio	5ug	EUR 155

Human Lymphocyte Antigen 86(LY86)ELISA Kit
QY-E02327	Qayee Biotechnology	96T	EUR 361

LY86 Protein Vector (Rat) (pPB-C-His)
PV280506	ABM	500 ng	EUR 603

LY86 Rabbit Polyclonal Antibody