CALCA Rabbit Polyclonal Antibody

CALCA Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

CALCA Polyclonal Antibody
ABP57963-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120
  • Applications tips:
Description: A polyclonal antibody for detection of CALCA from Human, Mouse, Rat. This CALCA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120
CALCA Polyclonal Antibody
ABP57963-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120
  • Applications tips:
Description: A polyclonal antibody for detection of CALCA from Human, Mouse, Rat. This CALCA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120
CALCA Polyclonal Antibody
ABP57963-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120
  • Applications tips:
Description: A polyclonal antibody for detection of CALCA from Human, Mouse, Rat. This CALCA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120
CALCA Polyclonal Antibody
ES11390-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CALCA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
CALCA Polyclonal Antibody
ES11390-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CALCA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
CALCA/CALCA Antibody
1-CSB-PA060153
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CALCA/CALCA. Recognizes CALCA/CALCA from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000
CALCA / CALCA Antibody
20-abx322895
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
CALCA Rabbit pAb
A13957-100ul 100 ul
EUR 308
CALCA Rabbit pAb
A13957-200ul 200 ul
EUR 459
CALCA Rabbit pAb
A13957-20ul 20 ul
EUR 183
CALCA Rabbit pAb
A13957-50ul 50 ul
EUR 223
CALCA Rabbit pAb
A11804-100ul 100 ul
EUR 308
CALCA Rabbit pAb
A11804-200ul 200 ul
EUR 459
CALCA Rabbit pAb
A11804-20ul 20 ul Ask for price
CALCA Rabbit pAb
A11804-50ul 50 ul Ask for price
Polyclonal CALCA Antibody (Center)
APR11539G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCA (Center). This antibody is tested and proven to work in the following applications:
CALCA/CALCB Polyclonal Conjugated Antibody
C31944 100ul
EUR 397
CALCA Polyclonal Antibody, Biotin Conjugated
A52254 100 µg
EUR 570.55
Description: kits suitable for this type of research
CALCA Polyclonal Antibody, FITC Conjugated
A52255 100 µg
EUR 570.55
Description: fast delivery possible
CALCA Polyclonal Antibody, HRP Conjugated
A52256 100 µg
EUR 570.55
Description: reagents widely cited
CALCA Antibody
32898-100ul 100ul
EUR 252
CALCA antibody
10R-8356 100 ul
EUR 392
Description: Mouse monoclonal CALCA antibody
CALCA Antibody
1-CSB-PA004434HA01DO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Dog. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000
CALCA Antibody
1-CSB-PA095703
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200
CALCA Antibody
1-CSB-PA12134A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA
CALCA Antibody
1-CSB-PA594619
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
CALCA Antibody
1-CSB-PA680635
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200
CALCA Antibody
DF7386 200ul
EUR 304
Description: CALCA Antibody detects endogenous levels of total CALCA.
CALCA Antibody
DF7785 200ul
EUR 304
Description: CALCA Antibody detects endogenous levels of total CALCA.
CALCA Antibody
1-CSB-PA182905
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100
CALCA Antibody
1-CSB-PA216407
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000
CALCA Antibody
ABD7386 100 ug
EUR 438
CALCA Antibody
ABD7785 100 ug
EUR 438
CALCA Antibody
ABD7786 100 ug
EUR 438
CALCA Antibody
ABD7985 100 ug
EUR 438
Polyclonal CALCA/CT Antibody (C-term)
APR04041G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCA/CT (C-term). This antibody is tested and proven to work in the following applications:
Rabbit Calcitonin (CALCA) ELISA Kit
abx256998-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
CALCA/CALCB antibody
31944-100ul 100ul
EUR 252
CALCA/CALCB antibody
31944-50ul 50ul
EUR 187
Calcitonin (CALCA) Antibody
20-abx007886
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
abx022516-20ul 20 ul
EUR 328
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
abx025389-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
abx025390-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
abx025390-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
abx026097-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
abx026097-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
20-abx004242
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
20-abx100229
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Calcitonin (CALCA) Antibody
20-abx131752
  • EUR 342.00
  • EUR 899.00
  • EUR 467.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.
Calcitonin (CALCA) Antibody
20-abx132191
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Calcitonin (CALCA) Antibody
20-abx132280
  • EUR 328.00
  • EUR 843.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.
Calcitonin (CALCA) Antibody
abx146688-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
20-abx146798
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
abx148151-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
abx028427-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
abx028427-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
CALCA Conjugated Antibody
C32898 100ul
EUR 397
Anti-CALCA antibody
STJ27531 100 µl
EUR 277
Description: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator and as an antimicrobial peptide while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-CALCA antibody
STJ113383 100 µl
EUR 277
Description: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator and as an antimicrobial peptide while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-CALCA antibody
STJ115892 100 µl
EUR 277
Description: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator and as an antimicrobial peptide while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-CALCA Antibody
STJ500585 100 µg
EUR 476
Anti-CALCA Antibody
STJ500586 100 µg
EUR 476
Anti-CALCA antibody
STJ192548 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CALCA
Calca/ Rat Calca ELISA Kit
ELI-25243r 96 Tests
EUR 886
CALCA Antibody, HRP conjugated
1-CSB-PA004434HB01DO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Dog. This antibody is HRP conjugated. Tested in the following application: ELISA
CALCA Antibody, FITC conjugated
1-CSB-PA004434HC01DO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Dog. This antibody is FITC conjugated. Tested in the following application: ELISA
CALCA Antibody, Biotin conjugated
1-CSB-PA004434HD01DO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Dog. This antibody is Biotin conjugated. Tested in the following application: ELISA
CALCA Antibody, HRP conjugated
1-CSB-PA12134B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
CALCA Antibody, FITC conjugated
1-CSB-PA12134C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
CALCA Antibody, Biotin conjugated
1-CSB-PA12134D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-Calcitonin/Calca Antibody
A02352 100ug/vial
EUR 334
Anti-Calcitonin/CALCA Antibody
PB9936 100ug/vial
EUR 334
Anti-Calcitonin/CALCA Antibody
PB9937 100ug/vial
EUR 334
Anti-CALCA Antibody (Biotin)
STJ500587 100 µg
EUR 586
Anti-CALCA Antibody (FITC)
STJ500588 100 µg
EUR 586
Anti-CALCA Antibody (Biotin)
STJ500589 100 µg
EUR 586
Anti-CALCA Antibody (FITC)
STJ500590 100 µg
EUR 586
Dog Calcitonin (CALCA)
1-CSB-EP004434DO
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 19.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Dog Calcitonin(CALCA),partial expressed in E.coli
CALCA Blocking Peptide
DF7386-BP 1mg
EUR 195
CALCA Blocking Peptide
DF7785-BP 1mg
EUR 195
CALCA cloning plasmid
CSB-CL004434HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 426
  • Sequence: atgggcttccaaaagttctcccccttcctggctctcagcatcttggtcctgttgcaggcaggcagcctccatgcagcaccattcaggtctgccctggagagcagcccagcagacccggccacgctcagtgaggacgaagcgcgcctcctgctggctgcactggtgcaggactatgt
  • Show more
Description: A cloning plasmid for the CALCA gene.
Monoclonal CALCA/CT Antibody, Clone: 406CT21.4.3
AMM02399G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human CALCA/CT. The antibodies are raised in Mouse and are from clone 406CT21.4.3. This antibody is applicable in WB, E
Human CALCA ELISA Kit
ELA-E1213h 96 Tests
EUR 824
CALCA ELISA KIT|Human
EF004510 96 Tests
EUR 689
Rat CALCA shRNA Plasmid
20-abx984395
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat CALCA shRNA Plasmid
20-abx984396
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human Katacalcin (CALCA) Protein
abx670053-01mg 0.1 mg
EUR 286
  • Shipped within 1 week.
Mouse CALCA shRNA Plasmid
20-abx969440
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse CALCA shRNA Plasmid
20-abx969441
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CALCA shRNA Plasmid
20-abx950557
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CALCA shRNA Plasmid
20-abx950558
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Canine CALCA ELISA KIT
ELI-50378d 96 Tests
EUR 928
CALCA Recombinant Protein (Human)
RP005446 100 ug Ask for price
CALCA Recombinant Protein (Rat)
RP192887 100 ug Ask for price
CALCA Recombinant Protein (Rat)
RP192890 100 ug Ask for price
CALCA Recombinant Protein (Rat)
RP192893 100 ug Ask for price
CALCA Recombinant Protein (Mouse)
RP120794 100 ug Ask for price
CALCA Recombinant Protein (Mouse)
RP120797 100 ug Ask for price
Mouse CALCA ELISA Kit
STJ150014 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of CT in Mouse serum, plasma and other biological fluids
Rat CALCA ELISA Kit
STJ150046 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of CT in Rat serum, plasma and other biological fluids
Human CALCA ELISA Kit
STJ150115 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of CT in human serum, plasma and other biological fluids
Mouse CALCA ELISA Kit
STJ150272 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of CGRP in Mouse serum, plasma and other biological fluids
Rat CALCA ELISA Kit
STJ150492 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of CGRP in Rat serum, plasma and other biological fluids
Calcitonin Gene-Related Peptide 1 (CALCA) Antibody
20-abx210915
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Calcitonin Gene-Related Peptide 1 (CALCA) Antibody
20-abx126848
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Calcitonin Gene-Related Peptide 1 (CALCA) Antibody
20-abx109590
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Monoclonal CALCA Antibody (monoclonal) (M01), Clone: 4B10
APR11540G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CALCA (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4B10. This antibody is applicable in WB, E
Calcitonin Gene-Related Peptide 1 (CALCA) Antibody
abx411020-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.
Calcitonin Gene-Related Peptide 1 (CALCA) Antibody
abx411021-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.
Calcitonin Gene-Related Peptide 1 (CALCA) Antibody
20-abx339270
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Calcitonin Gene-Related Peptide 1 (CALCA) Antibody
20-abx339887
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Calcitonin Gene-Related Peptide 1 (CALCA) Antibody
20-abx339888
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Calcitonin Gene-Related Peptide 1 (CALCA) Antibody
20-abx325007
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Calcitonin Gene-Related Peptide 1 (CALCA) Antibody
20-abx300595
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Monoclonal CALCA/CT Antibody(Ascites), Clone: 406CT21.4.3
AMM02398G 0.1 ml
EUR 484
Description: A Monoclonal antibody against Human CALCA/CT(Ascites). The antibodies are raised in Mouse and are from clone 406CT21.4.3. This antibody is applicable in WB, E
Mouse Calcitonin (CALCA) ELISA Kit
20-abx051635
  • EUR 6971.00
  • EUR 3714.00
  • EUR 864.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Dog Calcitonin (CALCA) ELISA Kit
20-abx150232
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Calcitonin (CALCA) ELISA Kit
20-abx153757
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Rat Calcitonin (CALCA) ELISA Kit
20-abx155290
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Calcitonin (CALCA) ELISA Kit
20-abx150900
  • EUR 6173.00
  • EUR 3291.00
  • EUR 770.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Calcitonin (CALCA) ELISA Kit
abx255294-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Calcitonin (CALCA) ELISA Kit
abx256835-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Calcitonin (CALCA) ELISA Kit
abx250659-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Calcitonin (CALCA) ELISA Kit
abx253160-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Calcitonin, Calca ELISA KIT
ELI-11082r 96 Tests
EUR 886
Canine Calcitonin, CALCA ELISA KIT
ELI-11765d 96 Tests
EUR 928
Mouse Calcitonin, Calca ELISA KIT
ELI-25043m 96 Tests
EUR 865
Monkey Calcitonin (CALCA) ELISA Kit
abx353353-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Pig Calcitonin (CALCA) ELISA Kit
abx353439-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Chicken Calcitonin (CALCA) ELISA Kit
abx354776-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Sheep Calcitonin (CALCA) ELISA Kit
abx355412-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.
Rat Calcitonin (CALCA) ELISA Kit
abx574172-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Calcitonin (CALCA) ELISA Kit
abx574173-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Chicken Calcitonin (CALCA) ELISA Kit
abx513048-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Bovine Calcitonin, CALCA ELISA KIT
ELI-33110b 96 Tests
EUR 928
Human Calcitonin, CALCA ELISA KIT
ELI-33111h 96 Tests
EUR 824
Porcine Calcitonin, CALCA ELISA KIT
ELI-34449p 96 Tests
EUR 928
Chicken Calcitonin, CALCA ELISA KIT
ELI-50377c 96 Tests
EUR 928
Calca ORF Vector (Rat) (pORF)
ORF064297 1.0 ug DNA
EUR 506
Calca ORF Vector (Rat) (pORF)
ORF064298 1.0 ug DNA
EUR 506
Calca ORF Vector (Rat) (pORF)
ORF064299 1.0 ug DNA
EUR 506
CALCA ORF Vector (Human) (pORF)
ORF001816 1.0 ug DNA
EUR 95
Calca ORF Vector (Mouse) (pORF)
ORF040266 1.0 ug DNA
EUR 506
Calca ORF Vector (Mouse) (pORF)
ORF040267 1.0 ug DNA
EUR 506
CALCA ELISA Kit (Human) (OKAN05175)
OKAN05175 96 Wells
EUR 792
Description: Description of target: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator and as an antimicrobial peptide while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12.7 pg/mL
CALCA ELISA Kit (Mouse) (OKAN05573)
OKAN05573 96 Wells
EUR 792
Description: Description of target: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide (CGRP) and katacalcin. Alternative splicing of the mRNA results in multiple variants that encode either calcitonin or CGRP preproproteins. Post-translational processing of the calcitonin and CGRP propeptides results in either calcitonin and katacalcin, or CGRP, respectively. Calcitonin and katacalcin modulate calcium levels in the blood stream. CGRP can function as a vasodilator and play a role in the transmission of pain. The human homolog of CGRP was found to have antimicrobial activity.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.64 pg/mL
CALCA ELISA Kit (Mouse) (OKCD00726)
OKCD00726 96 Wells
EUR 779
Description: Description of target: Causes a rapid but short-lived drop in the level of calcium and phosphate in blood by promoting the incorporation of those ions in the bones. ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.64 pg/mL
CALCA ELISA Kit (Mouse) (OKCA02348)
OKCA02348 96 Wells
EUR 983
Description: Description of target: CGRP induces vasodilation. It dilates a variety of vessels including the coronary, cerebral and systemic vasculature. Its abundance in the CNS also points toward a neurotransmitter or neuromodulator role. It also elevates platelet cAMP.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 3.12 pg/mL
CALCA ELISA Kit (Pig) (OKCA02484)
OKCA02484 96 Wells
EUR 930
Description: Description of target: CGRP induces vasodilation. It dilates a variety of vessels including the coronary, cerebral and systemic vasculature. Its abundance in the CNS also points toward a neurotransmitter or neuromodulator role. ;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Competitive Inhibition Immunoassay;Sensitivity: 15.6 pg/mL
CALCA ELISA Kit (Human) (OKCD06672)
OKCD06672 96 Wells
EUR 792
Description: Description of target: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator and as an antimicrobial peptide while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 12.7pg/mL
CALCA ELISA Kit (Rat) (OKCD06673)
OKCD06673 96 Wells
EUR 818
Description: Description of target: an inhibitor of lactotroph function and a potent vasodilator.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 6.1pg/mL
CALCA ELISA Kit (Human) (OKEH00875)
OKEH00875 96 Wells
EUR 740
Description: Description of target: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator and as an antimicrobial peptide while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10 pg/mL
CALCA ELISA Kit (Rat) (OKEH00876)
OKEH00876 96 Wells
EUR 662
Description: Description of target: an inhibitor of lactotroph function and a potent vasodilator;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.98 pg/mL
CALCA ELISA Kit (Mouse) (OKEH05611)
OKEH05611 96 Wells
EUR 662
Description: Description of target: CGRP induces vasodilation. It dilates a variety of vessels including the coronary, cerebral and systemic vasculature. Its abundance in the CNS also points toward a neurotransmitter or neuromodulator role. It also elevates platelet cAMP.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.78 pg/mL
CALCA ELISA Kit (Chicken) (OKEH07812)
OKEH07812 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 35pg/mL
CALCA ELISA Kit (Pig) (OKEH07813)
OKEH07813 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 25pg/mL
CALCA ELISA Kit (Porcine) (OKEI00660)
OKEI00660 96 Wells
EUR 741
Description: Description of target: Causes a rapid but short-lived drop in the level of calcium and phosphate in blood by promoting the incorporation of those ions in the bones. ;Species reactivity: Porcine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.375 pg/mL
CALCA ELISA Kit (Porcine) (OKEI00668)
OKEI00668 96 Wells
EUR 741
Description: Description of target: Causes a rapid but short-lived drop in the level of calcium and phosphate in blood by promoting the incorporation of those ions in the bones. ;Species reactivity: Porcine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.75 pg/mL
Calcitonin Gene-Related Peptide 1 (CALCA) Antibody (Biotin)
20-abx105204
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Calcitonin Gene-Related Peptide 1 (CALCA) Antibody (FITC)
20-abx106621
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Calcitonin Gene-Related Peptide 1 (CALCA) Antibody (HRP)
20-abx108038
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Calcitonin Gene-Related Peptide 1 (CALCA) Antibody (HRP)
20-abx300602
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Calcitonin Gene-Related Peptide 1 (CALCA) Antibody (FITC)
20-abx300603
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Calcitonin Gene-Related Peptide 1 (CALCA) Antibody (Biotin)
20-abx300604
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-Procalcitonin Antibody Clone CALCA-Q2, Unconjugated-100ug
QDX31-100ug 100ug
EUR 251
Anti-Procalcitonin Antibody Clone CALCA-Q7, Unconjugated-100ug
QDX32-100ug 100ug
EUR 251
Anti-Procalcitonin Antibody Clone CALCA-Q3, Unconjugated-100ug
QDX33-100ug 100ug
EUR 251
Recombinant Human Calcitonin/CALCA (C-6His)
CA21-10ug 10ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 7.4.
Recombinant Human Calcitonin/CALCA (C-6His)
CA21-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 7.4.
Recombinant Human Calcitonin/CALCA (C-6His)
CA21-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 7.4.
Recombinant Human Calcitonin/CALCA (C-6His)
CA21-50ug 50ug
EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 7.4.
Bovine Calcitonin(CALCA/CALC) ELISA kit
CSB-E17374B-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Bovine Calcitonin (CALCA/CALC) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Bovine Calcitonin(CALCA/CALC) ELISA kit
1-CSB-E17374B
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Bovine Calcitonin(CALCA/CALC) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
CALCA sgRNA CRISPR Lentivector set (Human)
K0354301 3 x 1.0 ug
EUR 339
Calca sgRNA CRISPR Lentivector set (Rat)
K7544801 3 x 1.0 ug
EUR 339
Calca sgRNA CRISPR Lentivector set (Mouse)
K4507901 3 x 1.0 ug
EUR 339
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

CALCA Rabbit Polyclonal Antibody