CDO1 Rabbit Polyclonal Antibody

CDO1 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

CDO1 Polyclonal Antibody
ABP58095-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human CDO1 protein Applications tips:
Description: A polyclonal antibody for detection of CDO1 from Human, Mouse, Rat. This CDO1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDO1 protein

CDO1 Polyclonal Antibody
ABP58095-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human CDO1 protein Applications tips:
Description: A polyclonal antibody for detection of CDO1 from Human, Mouse, Rat. This CDO1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDO1 protein

CDO1 Polyclonal Antibody
ABP58095-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human CDO1 protein Applications tips:
Description: A polyclonal antibody for detection of CDO1 from Human, Mouse, Rat. This CDO1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDO1 protein

CDO1 Rabbit pAb
A8402-100ul	Abclonal	100 ul	EUR 308

CDO1 Rabbit pAb
A8402-200ul	Abclonal	200 ul	EUR 459

CDO1 Rabbit pAb
A8402-20ul	Abclonal	20 ul	EUR 183

CDO1 Rabbit pAb
A8402-50ul	Abclonal	50 ul	EUR 223

CDO1 Antibody
ABD10174	Lifescience Market	100 ug	EUR 438

CDO1 Antibody
36337-100ul	SAB	100ul	EUR 252

CDO1 antibody
70R-16337	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CDO1 antibody

CDO1 Antibody
DF10174	Affbiotech	200ul	EUR 304
Description: CDO1 Antibody detects endogenous levels of total CDO1.

CDO1 Antibody
1-CSB-PA005099GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CDO1. Recognizes CDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CDO1 Antibody
1-CSB-PA621975ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CDO1. Recognizes CDO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CDO1 Antibody
1-CSB-PA438445	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDO1. Recognizes CDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

CDO1 Antibody
1-CSB-PA203536	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDO1. Recognizes CDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

CDO1 Conjugated Antibody
C36337	SAB	100ul	EUR 397

Anti-CDO1 antibody
STJ110700	St John's Laboratory	100 µl	EUR 277

Anti-CDO1 antibody
STJ192106	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to CDO1

Polyclonal Cysteine Dioxygenase / CDO1 Antibody (N-Terminus)
APR07473G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cysteine Dioxygenase / CDO1 (N-Terminus). This antibody is tested and proven to work in the following applications:

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse)
4-PAE248Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CDO1 (Met1~Asn200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1)

CDO1 siRNA
20-abx900982	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CDO1 siRNA
20-abx911336	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CDO1 siRNA
20-abx911337	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), APC
4-PAE248Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CDO1 (Met1~Asn200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with APC.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), Biotinylated
4-PAE248Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CDO1 (Met1~Asn200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with Biotin.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), Cy3
4-PAE248Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CDO1 (Met1~Asn200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with Cy3.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), FITC
4-PAE248Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CDO1 (Met1~Asn200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with FITC.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), HRP
4-PAE248Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CDO1 (Met1~Asn200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with HRP.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), PE
4-PAE248Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CDO1 (Met1~Asn200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with PE.

CDO1 Blocking Peptide
DF10174-BP	Affbiotech	1mg	EUR 195

CDO1 cloning plasmid
CSB-CL621975HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 603 Sequence: atggaacagaccgaagtgctgaagccacggaccctggctgatctgatccgcatcctgcaccagctctttgccggcgatgaggtcaatgtagaggaggtgcaggccatcatggaagcctacgagagcgaccccaccgagtgggcaatgtacgccaagttcgaccagtacaggtatac Show more
Description: A cloning plasmid for the CDO1 gene.

CDO1 Rabbit Polyclonal Antibody