CDO1 Rabbit Polyclonal Antibody
CDO1 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
CDO1 Polyclonal Antibody |
ABP58095-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human CDO1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CDO1 from Human, Mouse, Rat. This CDO1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDO1 protein |
CDO1 Polyclonal Antibody |
ABP58095-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CDO1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CDO1 from Human, Mouse, Rat. This CDO1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDO1 protein |
CDO1 Polyclonal Antibody |
ABP58095-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CDO1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CDO1 from Human, Mouse, Rat. This CDO1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDO1 protein |
CDO1 Rabbit pAb |
A8402-100ul |
Abclonal |
100 ul |
EUR 308 |
CDO1 Rabbit pAb |
A8402-200ul |
Abclonal |
200 ul |
EUR 459 |
CDO1 Rabbit pAb |
A8402-20ul |
Abclonal |
20 ul |
EUR 183 |
CDO1 Rabbit pAb |
A8402-50ul |
Abclonal |
50 ul |
EUR 223 |
CDO1 Antibody |
36337-100ul |
SAB |
100ul |
EUR 252 |
CDO1 antibody |
70R-16337 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CDO1 antibody |
CDO1 Antibody |
DF10174 |
Affbiotech |
200ul |
EUR 304 |
Description: CDO1 Antibody detects endogenous levels of total CDO1. |
CDO1 Antibody |
1-CSB-PA005099GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against CDO1. Recognizes CDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
CDO1 Antibody |
1-CSB-PA621975ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CDO1. Recognizes CDO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
CDO1 Antibody |
1-CSB-PA438445 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CDO1. Recognizes CDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
CDO1 Antibody |
1-CSB-PA203536 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CDO1. Recognizes CDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
CDO1 Conjugated Antibody |
C36337 |
SAB |
100ul |
EUR 397 |
Anti-CDO1 antibody |
STJ192106 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CDO1 |
Polyclonal Cysteine Dioxygenase / CDO1 Antibody (N-Terminus) |
APR07473G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cysteine Dioxygenase / CDO1 (N-Terminus). This antibody is tested and proven to work in the following applications: |
Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse) |
4-PAE248Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CDO1 (Met1~Asn200)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1) |
CDO1 siRNA |
20-abx900982 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CDO1 siRNA |
20-abx911336 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CDO1 siRNA |
20-abx911337 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), APC |
4-PAE248Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CDO1 (Met1~Asn200)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with APC. |
Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), Biotinylated |
4-PAE248Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CDO1 (Met1~Asn200)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with Biotin. |
Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), Cy3 |
4-PAE248Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CDO1 (Met1~Asn200)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with Cy3. |
Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), FITC |
4-PAE248Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CDO1 (Met1~Asn200)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with FITC. |
Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), HRP |
4-PAE248Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CDO1 (Met1~Asn200)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with HRP. |
Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), PE |
4-PAE248Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CDO1 (Met1~Asn200)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with PE. |
CDO1 Blocking Peptide |
DF10174-BP |
Affbiotech |
1mg |
EUR 195 |
CDO1 cloning plasmid |
CSB-CL621975HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 603
- Sequence: atggaacagaccgaagtgctgaagccacggaccctggctgatctgatccgcatcctgcaccagctctttgccggcgatgaggtcaatgtagaggaggtgcaggccatcatggaagcctacgagagcgaccccaccgagtgggcaatgtacgccaagttcgaccagtacaggtatac
- Show more
|
Description: A cloning plasmid for the CDO1 gene. |
CDO1 Rabbit Polyclonal Antibody