TBX6 Rabbit Polyclonal Antibody
TBX6 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
TBX6 Polyclonal Antibody |
ES11218-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against TBX6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TBX6 Polyclonal Antibody |
ABP60637-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human TBX6 protein at amino acid sequence of 230-310
- Applications tips:
|
Description: A polyclonal antibody for detection of TBX6 from Human, Mouse, Rat. This TBX6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBX6 protein at amino acid sequence of 230-310 |
TBX6 Polyclonal Antibody |
ABP60637-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human TBX6 protein at amino acid sequence of 230-310
- Applications tips:
|
Description: A polyclonal antibody for detection of TBX6 from Human, Mouse, Rat. This TBX6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBX6 protein at amino acid sequence of 230-310 |
TBX6 Polyclonal Antibody |
ABP60637-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TBX6 protein at amino acid sequence of 230-310
- Applications tips:
|
Description: A polyclonal antibody for detection of TBX6 from Human, Mouse, Rat. This TBX6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBX6 protein at amino acid sequence of 230-310 |
TBX6 Rabbit pAb |
A16979-100ul |
Abclonal |
100 ul |
EUR 308 |
TBX6 Rabbit pAb |
A16979-200ul |
Abclonal |
200 ul |
EUR 459 |
TBX6 Rabbit pAb |
A16979-20ul |
Abclonal |
20 ul |
EUR 183 |
TBX6 Rabbit pAb |
A16979-50ul |
Abclonal |
50 ul |
EUR 223 |
TBX6 antibody |
70R-20729 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TBX6 antibody |
TBX6 Antibody |
43507-100ul |
SAB |
100ul |
EUR 252 |
TBX6 Antibody |
1-CSB-PA023258GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against TBX6. Recognizes TBX6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
TBX6 Antibody |
1-CSB-PA023258LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TBX6. Recognizes TBX6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Polyclonal TBX6 Antibody (Center W158) |
APR03597G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBX6 (Center W158). This antibody is tested and proven to work in the following applications: |
Polyclonal TBX6 antibody - N-terminal region |
APR00629G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBX6 - N-terminal region. This antibody is tested and proven to work in the following applications: |
Polyclonal TBX6 antibody - N-terminal region |
APR00630G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBX6 - N-terminal region. This antibody is tested and proven to work in the following applications: |
T-box 6 (TBX6) polyclonal antibody |
ABP-PAB-11162 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Transcription Factors
- Brand:
|
TBX6 Conjugated Antibody |
C43507 |
SAB |
100ul |
EUR 397 |
anti- TBX6 antibody |
FNab08542 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: T-box 6
- Uniprot ID: O95947
- Gene ID: 6911
- Research Area: Stem Cells, Metabolism, Developmental biology
|
Description: Antibody raised against TBX6 |
Anti-TBX6 antibody |
STJ192376 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TBX6 |
TBX6 siRNA |
20-abx905487 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TBX6 siRNA |
20-abx936276 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TBX6 siRNA |
20-abx936277 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TBX6 Antibody, HRP conjugated |
1-CSB-PA023258LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TBX6. Recognizes TBX6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
TBX6 Antibody, FITC conjugated |
1-CSB-PA023258LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TBX6. Recognizes TBX6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
TBX6 Antibody, Biotin conjugated |
1-CSB-PA023258LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TBX6. Recognizes TBX6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
TBX6 cloning plasmid |
CSB-CL023258HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1311
- Sequence: atgtaccatccacgagaattgtacccgtccctgggggccggctaccgcctggggcccgcccaacctggggccgactccagcttcccacccgccctagcggagggctaccgctaccccgaactggacacccctaaactggattgcttcctctccgggatggaggctgctccccgca
- Show more
|
Description: A cloning plasmid for the TBX6 gene. |
Anti-TBX6 (2D11) |
YF-MA15744 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TBX6 |
Anti-TBX6 (3D6) |
YF-MA15745 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TBX6 |
Anti-TBX6 (3F6) |
YF-MA15746 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TBX6 |
Anti-TBX6 (1D11) |
YF-MA15747 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TBX6 |
Anti-TBX6 (3G9) |
YF-MA15748 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TBX6 |
Anti-TBX6 (3F8) |
YF-MA15749 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TBX6 |
Anti-TBX6 (3F11) |
YF-MA15750 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TBX6 |
T-Box 6 (TBX6) Antibody |
20-abx116009 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mouse T- box transcription factor TBX6, Tbx6 ELISA KIT |
ELI-53153m |
Lifescience Market |
96 Tests |
EUR 865 |
Human T- box transcription factor TBX6, TBX6 ELISA KIT |
ELI-46478h |
Lifescience Market |
96 Tests |
EUR 824 |
Human TBX6 shRNA Plasmid |
20-abx954737 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse TBX6 shRNA Plasmid |
20-abx973010 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat TBX6 shRNA Plasmid |
20-abx990618 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TBX6 Recombinant Protein (Human) |
RP031096 |
ABM |
100 ug |
Ask for price |
TBX6 Recombinant Protein (Rat) |
RP232541 |
ABM |
100 ug |
Ask for price |
TBX6 Recombinant Protein (Mouse) |
RP177695 |
ABM |
100 ug |
Ask for price |
T-Box Protein 6 (TBX6) Antibody |
abx122846-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
T-Box Protein 6 (TBX6) Antibody |
20-abx003056 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
T-Box Protein 6 (TBX6) Antibody |
abx026378-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
T-Box Protein 6 (TBX6) Antibody |
abx026378-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
T-Box Protein 6 (TBX6) Antibody |
abx026525-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
T-Box Protein 6 (TBX6) Antibody |
abx026525-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
T-Box Protein 6 (TBX6) Antibody |
abx238542-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
T-Box Protein 6 (TBX6) Antibody |
20-abx301812 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Monoclonal TBX6 Antibody (monoclonal) (M06), Clone: 1D11 |
AMM04176G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human TBX6 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 1D11. This antibody is applicable in WB and IF |
Monoclonal TBX6 Antibody (monoclonal) (M08), Clone: 3G9 |
AMM04177G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human TBX6 (monoclonal) (M08). The antibodies are raised in mouse and are from clone 3G9. This antibody is applicable in E |
T-Box Protein 6 (TBX6) Antibody (HRP) |
20-abx315341 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
T-Box Protein 6 (TBX6) Antibody (FITC) |
20-abx315342 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
T-Box Protein 6 (TBX6) Antibody (Biotin) |
20-abx315343 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tbx6 ORF Vector (Mouse) (pORF) |
ORF059233 |
ABM |
1.0 ug DNA |
EUR 506 |
TBX6 ORF Vector (Human) (pORF) |
ORF010366 |
ABM |
1.0 ug DNA |
EUR 95 |
Tbx6 ORF Vector (Rat) (pORF) |
ORF077515 |
ABM |
1.0 ug DNA |
EUR 506 |
TBX6 sgRNA CRISPR Lentivector set (Human) |
K2344601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tbx6 sgRNA CRISPR Lentivector set (Rat) |
K6168801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tbx6 sgRNA CRISPR Lentivector set (Mouse) |
K3972501 |
ABM |
3 x 1.0 ug |
EUR 339 |
TBX6 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2344602 |
ABM |
1.0 ug DNA |
EUR 154 |
TBX6 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2344603 |
ABM |
1.0 ug DNA |
EUR 154 |
TBX6 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2344604 |
ABM |
1.0 ug DNA |
EUR 154 |
TBX6 Rabbit Polyclonal Antibody