TBX6 Rabbit Polyclonal Antibody

TBX6 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

TBX6 Polyclonal Antibody
ES11218-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TBX6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
TBX6 Polyclonal Antibody
ABP60637-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TBX6 protein at amino acid sequence of 230-310
  • Applications tips:
Description: A polyclonal antibody for detection of TBX6 from Human, Mouse, Rat. This TBX6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBX6 protein at amino acid sequence of 230-310
TBX6 Polyclonal Antibody
ABP60637-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TBX6 protein at amino acid sequence of 230-310
  • Applications tips:
Description: A polyclonal antibody for detection of TBX6 from Human, Mouse, Rat. This TBX6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBX6 protein at amino acid sequence of 230-310
TBX6 Polyclonal Antibody
ABP60637-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TBX6 protein at amino acid sequence of 230-310
  • Applications tips:
Description: A polyclonal antibody for detection of TBX6 from Human, Mouse, Rat. This TBX6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBX6 protein at amino acid sequence of 230-310
TBX6 Rabbit pAb
A16979-100ul 100 ul
EUR 308
TBX6 Rabbit pAb
A16979-200ul 200 ul
EUR 459
TBX6 Rabbit pAb
A16979-20ul 20 ul
EUR 183
TBX6 Rabbit pAb
A16979-50ul 50 ul
EUR 223
TBX6 antibody
70R-20729 50 ul
EUR 435
Description: Rabbit polyclonal TBX6 antibody
TBX6 Antibody
43507-100ul 100ul
EUR 252
TBX6 Antibody
1-CSB-PA023258GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TBX6. Recognizes TBX6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
TBX6 Antibody
1-CSB-PA023258LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBX6. Recognizes TBX6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
Polyclonal TBX6 Antibody (Center W158)
APR03597G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBX6 (Center W158). This antibody is tested and proven to work in the following applications:
Polyclonal TBX6 antibody - N-terminal region
APR00629G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBX6 - N-terminal region. This antibody is tested and proven to work in the following applications:
Polyclonal TBX6 antibody - N-terminal region
APR00630G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBX6 - N-terminal region. This antibody is tested and proven to work in the following applications:
T-box 6 (TBX6) polyclonal antibody
ABP-PAB-11162 100 ug Ask for price
    • Product line: Transcription Factors
    • Brand:
TBX6 Conjugated Antibody
C43507 100ul
EUR 397
anti- TBX6 antibody
FNab08542 100µg
EUR 548.75
  • Immunogen: T-box 6
  • Uniprot ID: O95947
  • Gene ID: 6911
  • Research Area: Stem Cells, Metabolism, Developmental biology
Description: Antibody raised against TBX6
Anti-TBX6 antibody
PAab08542 100 ug
EUR 386
Anti-TBX6 antibody
STJ119283 100 µl
EUR 277
Anti-TBX6 antibody
STJ192376 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TBX6
TBX6 siRNA
20-abx905487
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TBX6 siRNA
20-abx936276
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TBX6 siRNA
20-abx936277
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TBX6 Antibody, HRP conjugated
1-CSB-PA023258LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBX6. Recognizes TBX6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TBX6 Antibody, FITC conjugated
1-CSB-PA023258LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBX6. Recognizes TBX6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TBX6 Antibody, Biotin conjugated
1-CSB-PA023258LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBX6. Recognizes TBX6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TBX6 cloning plasmid
CSB-CL023258HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1311
  • Sequence: atgtaccatccacgagaattgtacccgtccctgggggccggctaccgcctggggcccgcccaacctggggccgactccagcttcccacccgccctagcggagggctaccgctaccccgaactggacacccctaaactggattgcttcctctccgggatggaggctgctccccgca
  • Show more
Description: A cloning plasmid for the TBX6 gene.
Anti-TBX6 (2D11)
YF-MA15744 100 ug
EUR 363
Description: Mouse monoclonal to TBX6
Anti-TBX6 (3D6)
YF-MA15745 100 ug
EUR 363
Description: Mouse monoclonal to TBX6
Anti-TBX6 (3F6)
YF-MA15746 100 ug
EUR 363
Description: Mouse monoclonal to TBX6
Anti-TBX6 (1D11)
YF-MA15747 100 ug
EUR 363
Description: Mouse monoclonal to TBX6
Anti-TBX6 (3G9)
YF-MA15748 100 ug
EUR 363
Description: Mouse monoclonal to TBX6
Anti-TBX6 (3F8)
YF-MA15749 100 ug
EUR 363
Description: Mouse monoclonal to TBX6
Anti-TBX6 (3F11)
YF-MA15750 100 ug
EUR 363
Description: Mouse monoclonal to TBX6
T-Box 6 (TBX6) Antibody
20-abx116009
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Mouse T- box transcription factor TBX6, Tbx6 ELISA KIT
ELI-53153m 96 Tests
EUR 865
Human T- box transcription factor TBX6, TBX6 ELISA KIT
ELI-46478h 96 Tests
EUR 824
TBX6 ELISA KIT|Human
EF003487 96 Tests
EUR 689
Human TBX6 shRNA Plasmid
20-abx954737
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse TBX6 shRNA Plasmid
20-abx973010
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat TBX6 shRNA Plasmid
20-abx990618
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TBX6 Recombinant Protein (Human)
RP031096 100 ug Ask for price
TBX6 Recombinant Protein (Rat)
RP232541 100 ug Ask for price
TBX6 Recombinant Protein (Mouse)
RP177695 100 ug Ask for price
T-Box Protein 6 (TBX6) Antibody
abx122846-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
T-Box Protein 6 (TBX6) Antibody
20-abx003056
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
T-Box Protein 6 (TBX6) Antibody
abx026378-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
T-Box Protein 6 (TBX6) Antibody
abx026378-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
T-Box Protein 6 (TBX6) Antibody
abx026525-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
T-Box Protein 6 (TBX6) Antibody
abx026525-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
T-Box Protein 6 (TBX6) Antibody
abx238542-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
T-Box Protein 6 (TBX6) Antibody
20-abx301812
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Monoclonal TBX6 Antibody (monoclonal) (M06), Clone: 1D11
AMM04176G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TBX6 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 1D11. This antibody is applicable in WB and IF
Monoclonal TBX6 Antibody (monoclonal) (M08), Clone: 3G9
AMM04177G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TBX6 (monoclonal) (M08). The antibodies are raised in mouse and are from clone 3G9. This antibody is applicable in E
T-Box Protein 6 (TBX6) Antibody (HRP)
20-abx315341
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
T-Box Protein 6 (TBX6) Antibody (FITC)
20-abx315342
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
T-Box Protein 6 (TBX6) Antibody (Biotin)
20-abx315343
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tbx6 ORF Vector (Mouse) (pORF)
ORF059233 1.0 ug DNA
EUR 506
TBX6 ORF Vector (Human) (pORF)
ORF010366 1.0 ug DNA
EUR 95
Tbx6 ORF Vector (Rat) (pORF)
ORF077515 1.0 ug DNA
EUR 506
TBX6 sgRNA CRISPR Lentivector set (Human)
K2344601 3 x 1.0 ug
EUR 339
Tbx6 sgRNA CRISPR Lentivector set (Rat)
K6168801 3 x 1.0 ug
EUR 339
Tbx6 sgRNA CRISPR Lentivector set (Mouse)
K3972501 3 x 1.0 ug
EUR 339
TBX6 sgRNA CRISPR Lentivector (Human) (Target 1)
K2344602 1.0 ug DNA
EUR 154
TBX6 sgRNA CRISPR Lentivector (Human) (Target 2)
K2344603 1.0 ug DNA
EUR 154
TBX6 sgRNA CRISPR Lentivector (Human) (Target 3)
K2344604 1.0 ug DNA
EUR 154

TBX6 Rabbit Polyclonal Antibody