SLPI Rabbit Polyclonal Antibody

SLPI Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

SLPI Polyclonal Antibody

A51962 100 µg
EUR 570.55
Description: reagents widely cited

SLPI Polyclonal Antibody

ABP60433-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SLPI protein
  • Applications tips:
Description: A polyclonal antibody for detection of SLPI from Human, Mouse. This SLPI antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SLPI protein

SLPI Polyclonal Antibody

ABP60433-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SLPI protein
  • Applications tips:
Description: A polyclonal antibody for detection of SLPI from Human, Mouse. This SLPI antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SLPI protein

SLPI Polyclonal Antibody

ABP60433-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SLPI protein
  • Applications tips:
Description: A polyclonal antibody for detection of SLPI from Human, Mouse. This SLPI antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SLPI protein

SLPI Polyclonal Antibody

ES11078-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SLPI from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SLPI Polyclonal Antibody

ES11078-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SLPI from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SLPI Rabbit pAb

A1897-100ul 100 ul
EUR 308

SLPI Rabbit pAb

A1897-200ul 200 ul
EUR 459

SLPI Rabbit pAb

A1897-20ul 20 ul
EUR 183

SLPI Rabbit pAb

A1897-50ul 50 ul
EUR 223

Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

DLR-SLPI-Hu-48T 48T
EUR 498
  • Should the Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Secretory Leukocyte Peptidase Inhibitor (SLPI) in samples from serum, plasma or other biological fluids.

Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

DLR-SLPI-Hu-96T 96T
EUR 647
  • Should the Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Secretory Leukocyte Peptidase Inhibitor (SLPI) in samples from serum, plasma or other biological fluids.

Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

DLR-SLPI-Mu-48T 48T
EUR 508
  • Should the Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

DLR-SLPI-Mu-96T 96T
EUR 661
  • Should the Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

RD-SLPI-Hu-48Tests 48 Tests
EUR 500

Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

RD-SLPI-Hu-96Tests 96 Tests
EUR 692

Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

RD-SLPI-Mu-48Tests 48 Tests
EUR 511

Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

RD-SLPI-Mu-96Tests 96 Tests
EUR 709

Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

RDR-SLPI-Hu-48Tests 48 Tests
EUR 522

Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

RDR-SLPI-Hu-96Tests 96 Tests
EUR 724

Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

RDR-SLPI-Mu-48Tests 48 Tests
EUR 534

Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

RDR-SLPI-Mu-96Tests 96 Tests
EUR 742

Rabbit SLPI ELISA Kit

ERTS0123 96Tests
EUR 521

SLPI Polyclonal Antibody, HRP Conjugated

A51963 100 µg
EUR 570.55
Description: Ask the seller for details

SLPI Polyclonal Antibody, FITC Conjugated

A51964 100 µg
EUR 570.55
Description: The best epigenetics products

SLPI Polyclonal Antibody, Biotin Conjugated

A51965 100 µg
EUR 570.55
Description: kits suitable for this type of research

SLPI Antibody

24542-100ul 100ul
EUR 390

SLPI Antibody

24543-100ul 100ul
EUR 390

SLPI antibody

70R-15411 100 ug
EUR 327
Description: Rabbit polyclonal SLPI antibody

SLPI antibody

38316-100ul 100ul
EUR 252

SLPI Antibody

1-CSB-PA07154A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLPI. Recognizes SLPI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

SLPI antibody

70R-9706 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SLPI antibody

SLPI antibody (HRP)

60R-2044 100 ug
EUR 327
Description: Rabbit polyclonal SLPI antibody (HRP)

SLPI antibody (FITC)

60R-2045 100 ug
EUR 327
Description: Rabbit polyclonal SLPI antibody (FITC)

SLPI antibody (biotin)

60R-2046 100 ug
EUR 327
Description: Rabbit polyclonal SLPI antibody (biotin)

Anti-SLPI Antibody

A01682-1 100ug/vial
EUR 334

Antileukoproteinase (SLPI) Antibody

20-abx109544
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SLPI Conjugated Antibody

C38316 100ul
EUR 397

Anti-SLPI antibody

STJ11100591 100 µl
EUR 277
Description: This gene encodes a secreted inhibitor which protects epithelial tissues from serine proteases. It is found in various secretions including seminal plasma, cervical mucus, and bronchial secretions, and has affinity for trypsin, leukocyte elastase, and cathepsin G. Its inhibitory effect contributes to the immune response by protecting epithelial surfaces from attack by endogenous proteolytic enzymes. This antimicrobial protein has antibacterial, antifungal and antiviral activity.

Anti-SLPI antibody

STJ16100138 100 µg
EUR 899

Anti-SLPI antibody

STJ16100139 50 µg
EUR 704

Anti-SLPI antibody

STJ192236 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SLPI

SLPI siRNA

20-abx934267
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SLPI siRNA

20-abx934268
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-SLPI

YF-PA24724 50 ul
EUR 334
Description: Mouse polyclonal to SLPI

anti-SLPI

YF-PA27362 50 ug
EUR 363
Description: Mouse polyclonal to SLPI

SLPI Antibody, HRP conjugated

1-CSB-PA07154B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLPI. Recognizes SLPI from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SLPI Antibody, FITC conjugated

1-CSB-PA07154C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLPI. Recognizes SLPI from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SLPI Antibody, Biotin conjugated

1-CSB-PA07154D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLPI. Recognizes SLPI from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse)

4-PAB312Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SLPI (Pro20~Met131)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI)

SLPI cloning plasmid

CSB-CL021781HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 399
  • Sequence: atgaagtccagcggcctcttccccttcctggtgctgcttgccctgggaactctggcaccttgggctgtggaaggctctggaaagtccttcaaagctggagtctgtcctcctaagaaatctgcccagtgccttagatacaagaaacctgagtgccagagtgactggcagtgtccagg
  • Show more
Description: A cloning plasmid for the SLPI gene.

Anti-SLPI (3C6)

YF-MA15457 100 ug
EUR 363
Description: Mouse monoclonal to SLPI

Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), APC

4-PAB312Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SLPI (Pro20~Met131)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with APC.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), Biotinylated

4-PAB312Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SLPI (Pro20~Met131)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with Biotin.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), Cy3

4-PAB312Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SLPI (Pro20~Met131)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with Cy3.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), FITC

4-PAB312Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SLPI (Pro20~Met131)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with FITC.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), HRP

4-PAB312Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SLPI (Pro20~Met131)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with HRP.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), PE

4-PAB312Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SLPI (Pro20~Met131)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with PE.

Rabbit Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

abx363252-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), APC-Cy7

4-PAB312Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SLPI (Pro20~Met131)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with APC-Cy7.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody

20-abx178335
  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody

20-abx178336
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody

20-abx104088
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody

20-abx174486
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Secretory Leukocyte Protease Inhibitor (SLPI) Antibody

abx411960-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

SLPI protein (His tag)

80R-1362 50 ug
EUR 397
Description: Purified recombinant Human SLPI protein

Human SLPI ELISA Kit

ELA-E1312h 96 Tests
EUR 824

Human SLPI ELISA Kit

EHS0123 96Tests
EUR 521

Bovine SLPI ELISA Kit

EBS0123 96Tests
EUR 521

Anserini SLPI ELISA Kit

EAS0123 96Tests
EUR 521

Chicken SLPI ELISA Kit

ECKS0123 96Tests
EUR 521

Canine SLPI ELISA Kit

ECS0123 96Tests
EUR 521

Goat SLPI ELISA Kit

EGTS0123 96Tests
EUR 521

SLPI ELISA KIT|Human

EF000380 96 Tests
EUR 689

Mouse SLPI shRNA Plasmid

20-abx972769
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SLPI shRNA Plasmid

20-abx954476
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Porcine SLPI ELISA Kit

EPS0123 96Tests
EUR 521

Sheep SLPI ELISA Kit

ESS0123 96Tests
EUR 521

Rat SLPI ELISA Kit

ERS0123 96Tests
EUR 521

Monkey SLPI ELISA Kit

EMKS0123 96Tests
EUR 521

Mouse SLPI ELISA Kit

EMS0123 96Tests
EUR 521

SLPI Recombinant Protein (Rat)

RP229982 100 ug Ask for price

SLPI Recombinant Protein (Human)

RP029323 100 ug Ask for price

SLPI Recombinant Protein (Mouse)

RP173741 100 ug Ask for price

Secretory Leukocyte Protease Inhibitor (SLPI) Antibody Pair

abx117629-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody (Biotin)

20-abx272778
  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody Pair

20-abx370266
  • EUR 1706.00
  • EUR 1094.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody (FITC)

20-abx273938
  • EUR 467.00
  • EUR 244.00
  • EUR 1386.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse SLPI PicoKine ELISA Kit

EK1996 96 wells
EUR 425
Description: For quantitative detection of mouse SLPI in cell culture supernates, serum and plasma (heparin, EDTA).

Guinea Pig SLPI ELISA Kit

EGS0123 96Tests
EUR 521

Human SLPI/ Antileukoproteinase ELISA Kit

E2340Hu 1 Kit
EUR 537

Mouse Antileukoproteinase, Slpi ELISA KIT

ELI-04340m 96 Tests
EUR 865

Human Antileukoproteinase, SLPI ELISA KIT

ELI-04341h 96 Tests
EUR 824

Porcine Antileukoproteinase, SLPI ELISA KIT

ELI-04342p 96 Tests
EUR 928

Slpi ORF Vector (Rat) (pORF)

ORF076662 1.0 ug DNA
EUR 506

SLPI ORF Vector (Human) (pORF)

ORF009775 1.0 ug DNA
EUR 95

Slpi ORF Vector (Mouse) (pORF)

ORF057915 1.0 ug DNA
EUR 506

SLPI ELISA Kit (Mouse) (OKAN05921)

OKAN05921 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.3 pg/mL

SLPI ELISA Kit (Human) (OKAN06205)

OKAN06205 96 Wells
EUR 792
Description: Description of target: This gene encodes a secreted inhibitor which protects epithelial tissues from serine proteases. It is found in various secretions including seminal plasma, cervical mucus, and bronchial secretions, and has affinity for trypsin, leukocyte elastase, and cathepsin G. Its inhibitory effect contributes to the immune response by protecting epithelial surfaces from attack by endogenous proteolytic enzymes. This antimicrobial protein has antibacterial, antifungal and antiviral activity.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 27.1 pg/mL

Slpi ELISA Kit (Mouse) (OKBB01366)

OKBB01366 96 Wells
EUR 505
Description: Description of target: Antileukoproteinase, also known as secretory leukocyte protease inhibitor (SLPI), is an enzyme that in humans is encoded by the SLPI gene. It is mapped to 2; 2 H3. SLPI is a highly cationic single-chain protein with eight intramolecular disulfide bonds. It is found in large quantities in bronchial, cervical, and nasal mucosa, saliva, and seminal fluids. SLPI inhibits human leukocyte elastase, human cathepsin G, human trypsin, neutrophil elastase, and mast cell chymase. X-ray crystallography has shown that SLPI has two homologous domains of 53 and 54 amino acids, one of which exhibits anti-protease activity (C-terminal domain). The other domain (N-terminal domain) is not known to have any function.This gene encodes a secreted inhibitor which protects epithelial tissues from serine proteases. It is found in various secretions including seminal plasma, cervical mucus, and bronchial secretions, and has affinity for trypsin, leukocyte elastase, and cathepsin G. Its inhibitory effect contributes to the immune response by protecting epithelial surfaces from attack by endogenous proteolytic enzymes; the protein is also thought to have broad-spectrum anti-biotic activity.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

SLPI ELISA Kit (Mouse) (OKCD00172)

OKCD00172 96 Wells
EUR 818
Description: Description of target: Acid-stable proteinase inhibitor with strong affinities for trypsin, chymotrypsin, elastase, and cathepsin G. Modulates the innate immune response after bacterial infection. Contributes to regulate the inflammatory and immune responses to the intracellular parasite L.major. Down-regulates responses to bacterial lipopolysaccharide (LPS). Plays a role in regulating the activation of NF-kappa-B and inflammatory responses. Has antimicrobial activity against mycobacteria, but not against salmonella. Contributes to normal resistance against infection by M.tuberculosis. Required for normal resistance to L.major. Required for normal wound healing, probably by preventing tissue damage by limiting protease activity. Together with ELANE, required for normal differentiation and proliferation of bone marrow myeloid cells.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 6.5 pg/mL

SLPI ELISA Kit (Human) (OKCD07307)

OKCD07307 96 Wells
EUR 936
Description: Description of target: This gene encodes a secreted inhibitor which protects epithelial tissues from serine proteases. It is found in various secretions including seminal plasma, cervical mucus, and bronchial secretions, and has affinity for trypsin, leukocyte elastase, and cathepsin G. Its inhibitory effect contributes to the immune response by protecting epithelial surfaces from attack by endogenous proteolytic enzymes; the protein is also thought to have broad-spectrum anti-biotic activity.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 27.1pg/mL

SLPI ELISA Kit (Human) (OKEH04022)

OKEH04022 96 Wells
EUR 544
Description: Description of target: This gene encodes a secreted inhibitor which protects epithelial tissues from serine proteases. It is found in various secretions including seminal plasma, cervical mucus, and bronchial secretions, and has affinity for trypsin, leukocyte elastase, and cathepsin G. Its inhibitory effect contributes to the immune response by protecting epithelial surfaces from attack by endogenous proteolytic enzymes. This antimicrobial protein has antibacterial, antifungal and antiviral activity.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12 pg/mL

SLPI ELISA Kit (Mouse) (OKEH06411)

OKEH06411 96 Wells
EUR 662
Description: Description of target: Acid-stable proteinase inhibitor with strong affinities for trypsin, chymotrypsin, elastase, and cathepsin G. Modulates the innate immune response after bacterial infection. Contributes to regulate the inflammatory and immune responses to the intracellular parasite L.major. Down-regulates responses to bacterial lipopolysaccharide (LPS). Plays a role in regulating the activation of NF-kappa-B and inflammatory responses. Has antimicrobial activity against mycobacteria, but not against salmonella. Contributes to normal resistance against infection by M.tuberculosis. Required for normal resistance to L.major. Required for normal wound healing, probably by preventing tissue damage by limiting protease activity. Together with ELANE, required for normal differentiation and proliferation of bone marrow myeloid cells.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

SLPI ELISA Kit (Rat) (OKEI00834)

OKEI00834 96 Wells
EUR 767
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

Secretory Leukocyte Protease Inhibitor (SLPI) Protein

20-abx262896
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Slpi sgRNA CRISPR Lentivector set (Rat)

K7074101 3 x 1.0 ug
EUR 339

SLPI sgRNA CRISPR Lentivector set (Human)

K2197001 3 x 1.0 ug
EUR 339

Slpi sgRNA CRISPR Lentivector set (Mouse)

K3720101 3 x 1.0 ug
EUR 339

Recombinant Secretory Leukocyte Peptidase Inhibitor (SLPI)

4-RPB312Mu01
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P97430
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.1kDa
  • Isoelectric Point: 8.7
Description: Recombinant Mouse Secretory Leukocyte Peptidase Inhibitor expressed in: E.coli

Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) Protein

20-abx069004
  • EUR 759.00
  • EUR 300.00
  • EUR 2388.00
  • EUR 913.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Secretory Leukocyte Peptidase Inhibitor (SLPI) Protein

20-abx655013
  • EUR 425.00
  • EUR 230.00
  • EUR 1149.00
  • EUR 495.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Slpi sgRNA CRISPR Lentivector (Rat) (Target 1)

K7074102 1.0 ug DNA
EUR 154

Slpi sgRNA CRISPR Lentivector (Rat) (Target 2)

K7074103 1.0 ug DNA
EUR 154

Slpi sgRNA CRISPR Lentivector (Rat) (Target 3)

K7074104 1.0 ug DNA
EUR 154

SLPI sgRNA CRISPR Lentivector (Human) (Target 1)

K2197002 1.0 ug DNA
EUR 154

SLPI sgRNA CRISPR Lentivector (Human) (Target 2)

K2197003 1.0 ug DNA
EUR 154

SLPI sgRNA CRISPR Lentivector (Human) (Target 3)

K2197004 1.0 ug DNA
EUR 154

Slpi sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3720102 1.0 ug DNA
EUR 154

Slpi sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3720103 1.0 ug DNA
EUR 154

Slpi sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3720104 1.0 ug DNA
EUR 154

SLPI Protein Vector (Rat) (pPB-C-His)

PV306646 500 ng
EUR 603

SLPI Protein Vector (Rat) (pPB-N-His)

PV306647 500 ng
EUR 603

SLPI Protein Vector (Rat) (pPM-C-HA)

PV306648 500 ng
EUR 603

SLPI Protein Vector (Rat) (pPM-C-His)

PV306649 500 ng
EUR 603

SLPI Protein Vector (Human) (pPB-C-His)

PV039097 500 ng
EUR 329

SLPI Protein Vector (Human) (pPB-N-His)

PV039098 500 ng
EUR 329

SLPI Protein Vector (Human) (pPM-C-HA)

PV039099 500 ng
EUR 329

SLPI Protein Vector (Human) (pPM-C-His)

PV039100 500 ng
EUR 329

SLPI Protein Vector (Mouse) (pPB-C-His)

PV231658 500 ng
EUR 603

SLPI Protein Vector (Mouse) (pPB-N-His)

PV231659 500 ng
EUR 603

SLPI Protein Vector (Mouse) (pPM-C-HA)

PV231660 500 ng
EUR 603

SLPI Protein Vector (Mouse) (pPM-C-His)

PV231661 500 ng
EUR 603

Recombinant Human SLPI Protein, His, E.coli-10ug

QP13524-10ug 10ug
EUR 201

Recombinant Human SLPI Protein, His, E.coli-1mg

QP13524-1mg 1mg
EUR 5251

Recombinant Human SLPI Protein, His, E.coli-2ug

QP13524-2ug 2ug
EUR 155

Slpi 3'UTR Luciferase Stable Cell Line

TU119278 1.0 ml Ask for price

Slpi 3'UTR GFP Stable Cell Line

TU169278 1.0 ml Ask for price

Slpi 3'UTR Luciferase Stable Cell Line

TU220796 1.0 ml Ask for price

Slpi 3'UTR GFP Stable Cell Line

TU270796 1.0 ml Ask for price

SLPI 3'UTR GFP Stable Cell Line

TU073688 1.0 ml
EUR 1394

SLPI 3'UTR Luciferase Stable Cell Line

TU023688 1.0 ml
EUR 1394

SLPI Chemi-Luminescent ELISA Kit (Mouse) (OKCD03926)

OKCD03926 96 Wells
EUR 1027
Description: Description of target: Acid-stable proteinase inhibitor with strong affinities for trypsin, chymotrypsin, elastase, and cathepsin G . Modulates the innate immune response after bacterial infection . Contributes to regulate the inflammatory and immune responses to the intracellular parasite L.major . Down-regulates responses to bacterial lipopolysaccharide (LPS) . Plays a role in regulating the activation of NF-kappa-B and inflammatory responses . Has antimicrobial activity against mycobacteria, but not against salmonella . Contributes to normal resistance against infection by M.tuberculosis . Required for normal resistance to L.major . Required for normal wound healing, probably by preventing tissue damage by limiting protease activity . Together with ELANE, required for normal differentiation and proliferation of bone marrow myeloid cells .;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

SLPI Rabbit Polyclonal Antibody