EXTL3 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

EXTL3 Polyclonal Antibody
ES10967-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against EXTL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EXTL3 Polyclonal Antibody
ES10967-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against EXTL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EXTL3 Rabbit pAb
A3857-100ul	Abclonal	100 ul	EUR 308

EXTL3 Rabbit pAb
A3857-200ul	Abclonal	200 ul	EUR 459

EXTL3 Rabbit pAb
A3857-20ul	Abclonal	20 ul	EUR 183

EXTL3 Rabbit pAb
A3857-50ul	Abclonal	50 ul	EUR 223

EXTL3 antibody
70R-17181	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal EXTL3 antibody

EXTL3 antibody
70R-15308	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal EXTL3 antibody

EXTL3 Antibody
36453-100ul	SAB	100ul	EUR 252

EXTL3 Antibody
1-CSB-PA794242	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

EXTL3 Antibody
DF12993	Affbiotech	200ul	EUR 304
Description: EXTL3 Antibody detects endogenous levels of EXTL3.

EXTL3 Antibody
1-CSB-PA399518	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

EXTL3 Antibody
1-CSB-PA03075A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

EXTL3 Antibody
1-CSB-PA007905GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

EXTL3 Polyclonal Antibody, HRP Conjugated
A51670	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

EXTL3 Polyclonal Antibody, FITC Conjugated
A51671	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

EXTL3 Polyclonal Antibody, Biotin Conjugated
A51672	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

EXTL3 antibody (HRP)
60R-1754	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal EXTL3 antibody (HRP)

EXTL3 antibody (FITC)
60R-1755	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal EXTL3 antibody (FITC)

EXTL3 antibody (biotin)
60R-1756	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal EXTL3 antibody (biotin)

EXTL3 Conjugated Antibody
C36453	SAB	100ul	EUR 397

anti- EXTL3 antibody
FNab02912	FN Test	100µg	EUR 505.25
Immunogen: exostoses(multiple)-like 3 Uniprot ID: O43909 Gene ID: 2137 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against EXTL3

Anti-EXTL3 antibody
PAab02912	Lifescience Market	100 ug	EUR 355

Anti-EXTL3 antibody
STJ23590	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a single-pass membrane protein which functions as a glycosyltransferase. The encoded protein catalyzes the transfer of N-acetylglucosamine to glycosaminoglycan chains. This reaction is important in heparin and heparan sulfate synthesis. Alternative splicing results in the multiple transcript variants.

Anti-EXTL3 antibody
STJ192125	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to EXTL3

EXTL3 siRNA
20-abx915845	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EXTL3 Antibody, HRP conjugated
1-CSB-PA03075B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EXTL3 Antibody, FITC conjugated
1-CSB-PA03075C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EXTL3 Antibody, Biotin conjugated
1-CSB-PA03075D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EXTL3 Blocking Peptide
DF12993-BP	Affbiotech	1mg	EUR 195

EXTL3 cloning plasmid
CSB-CL007905HU-10ug	Cusabio	10ug	EUR 558
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2760 Sequence: atgacaggctataccatgctgcggaatgggggcgcggggaacggaggtcagacctgcatgctgcgctggtccaaccgcatccgcctcacgtggctcagcttcacgctctttgtcatcctggtcttcttcccgctcatcgcccactattacctcaccactctggatgaggctgatg Show more
Description: A cloning plasmid for the EXTL3 gene.

EXTL3 ELISA KIT|Human
EF009489	Lifescience Market	96 Tests	EUR 689

Human EXTL3 shRNA Plasmid
20-abx951486	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody
20-abx002804	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody
20-abx212396	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody
20-abx212881	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody
20-abx112418	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody
abx036241-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody
20-abx109769	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody
abx034206-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody
abx034206-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody
abx232912-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody (Biotin)
20-abx105397	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody (FITC)
20-abx106816	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody (HRP)
20-abx108235	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody Pair
abx117473-1pair5x96wellplates	Abbexa	1 pair (5x96 well plates)	EUR 1010
Shipped within 5-10 working days.

Extl3 ORF Vector (Rat) (pORF)
ORF066717	ABM	1.0 ug DNA	EUR 506

EXTL3 ORF Vector (Human) (pORF)
ORF003697	ABM	1.0 ug DNA	EUR 95

Extl3 ORF Vector (Mouse) (pORF)
ORF044189	ABM	1.0 ug DNA	EUR 506

EXTL3 sgRNA CRISPR Lentivector set (Human)
K0705201	ABM	3 x 1.0 ug	EUR 339

EXTL3 Rabbit Polyclonal Antibody