EXTL3 Rabbit Polyclonal Antibody
EXTL3 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
EXTL3 Polyclonal Antibody |
ES10967-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against EXTL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
EXTL3 Polyclonal Antibody |
ES10967-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against EXTL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
EXTL3 Rabbit pAb |
A3857-100ul |
Abclonal |
100 ul |
EUR 308 |
EXTL3 Rabbit pAb |
A3857-200ul |
Abclonal |
200 ul |
EUR 459 |
EXTL3 Rabbit pAb |
A3857-20ul |
Abclonal |
20 ul |
EUR 183 |
EXTL3 Rabbit pAb |
A3857-50ul |
Abclonal |
50 ul |
EUR 223 |
EXTL3 antibody |
70R-17181 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal EXTL3 antibody |
EXTL3 antibody |
70R-15308 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal EXTL3 antibody |
EXTL3 Antibody |
36453-100ul |
SAB |
100ul |
EUR 252 |
EXTL3 Antibody |
1-CSB-PA794242 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300 |
EXTL3 Antibody |
DF12993 |
Affbiotech |
200ul |
EUR 304 |
Description: EXTL3 Antibody detects endogenous levels of EXTL3. |
EXTL3 Antibody |
1-CSB-PA399518 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
EXTL3 Antibody |
1-CSB-PA03075A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200 |
EXTL3 Antibody |
1-CSB-PA007905GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
EXTL3 Polyclonal Antibody, HRP Conjugated |
A51670 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
EXTL3 Polyclonal Antibody, FITC Conjugated |
A51671 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
EXTL3 Polyclonal Antibody, Biotin Conjugated |
A51672 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
EXTL3 antibody (HRP) |
60R-1754 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal EXTL3 antibody (HRP) |
EXTL3 antibody (FITC) |
60R-1755 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal EXTL3 antibody (FITC) |
EXTL3 antibody (biotin) |
60R-1756 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal EXTL3 antibody (biotin) |
EXTL3 Conjugated Antibody |
C36453 |
SAB |
100ul |
EUR 397 |
anti- EXTL3 antibody |
FNab02912 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: exostoses(multiple)-like 3
- Uniprot ID: O43909
- Gene ID: 2137
- Research Area: Cardiovascular, Metabolism
|
Description: Antibody raised against EXTL3 |
Anti-EXTL3 antibody |
STJ23590 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a single-pass membrane protein which functions as a glycosyltransferase. The encoded protein catalyzes the transfer of N-acetylglucosamine to glycosaminoglycan chains. This reaction is important in heparin and heparan sulfate synthesis. Alternative splicing results in the multiple transcript variants. |
Anti-EXTL3 antibody |
STJ192125 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to EXTL3 |
EXTL3 siRNA |
20-abx915845 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EXTL3 Antibody, HRP conjugated |
1-CSB-PA03075B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
EXTL3 Antibody, FITC conjugated |
1-CSB-PA03075C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
EXTL3 Antibody, Biotin conjugated |
1-CSB-PA03075D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
EXTL3 Blocking Peptide |
DF12993-BP |
Affbiotech |
1mg |
EUR 195 |
EXTL3 cloning plasmid |
CSB-CL007905HU-10ug |
Cusabio |
10ug |
EUR 558 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2760
- Sequence: atgacaggctataccatgctgcggaatgggggcgcggggaacggaggtcagacctgcatgctgcgctggtccaaccgcatccgcctcacgtggctcagcttcacgctctttgtcatcctggtcttcttcccgctcatcgcccactattacctcaccactctggatgaggctgatg
- Show more
|
Description: A cloning plasmid for the EXTL3 gene. |
Human EXTL3 shRNA Plasmid |
20-abx951486 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Exostoses (Multiple)-Like 3 (EXTL3) Antibody |
20-abx002804 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Exostoses (Multiple)-Like 3 (EXTL3) Antibody |
20-abx212396 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Exostoses (Multiple)-Like 3 (EXTL3) Antibody |
20-abx212881 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Exostoses (Multiple)-Like 3 (EXTL3) Antibody |
20-abx112418 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Exostoses (Multiple)-Like 3 (EXTL3) Antibody |
abx036241-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Exostoses (Multiple)-Like 3 (EXTL3) Antibody |
20-abx109769 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Exostoses (Multiple)-Like 3 (EXTL3) Antibody |
abx034206-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Exostoses (Multiple)-Like 3 (EXTL3) Antibody |
abx034206-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Exostoses (Multiple)-Like 3 (EXTL3) Antibody |
abx232912-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Exostoses (Multiple)-Like 3 (EXTL3) Antibody (Biotin) |
20-abx105397 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Exostoses (Multiple)-Like 3 (EXTL3) Antibody (FITC) |
20-abx106816 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Exostoses (Multiple)-Like 3 (EXTL3) Antibody (HRP) |
20-abx108235 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Exostoses (Multiple)-Like 3 (EXTL3) Antibody Pair |
abx117473-1pair5x96wellplates |
Abbexa |
1 pair (5x96 well plates) |
EUR 1010 |
- Shipped within 5-10 working days.
|
Extl3 ORF Vector (Rat) (pORF) |
ORF066717 |
ABM |
1.0 ug DNA |
EUR 506 |
EXTL3 ORF Vector (Human) (pORF) |
ORF003697 |
ABM |
1.0 ug DNA |
EUR 95 |
Extl3 ORF Vector (Mouse) (pORF) |
ORF044189 |
ABM |
1.0 ug DNA |
EUR 506 |
EXTL3 sgRNA CRISPR Lentivector set (Human) |
K0705201 |
ABM |
3 x 1.0 ug |
EUR 339 |
EXTL3 Rabbit Polyclonal Antibody