GFRA2 Rabbit Polyclonal Antibody
GFRA2 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
GFRA2 Polyclonal Antibody |
ES11190-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against GFRA2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GFRA2 Polyclonal Antibody |
ABP58634-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human GFRA2 protein at amino acid sequence of 320-400
- Applications tips:
|
Description: A polyclonal antibody for detection of GFRA2 from Human, Mouse. This GFRA2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GFRA2 protein at amino acid sequence of 320-400 |
GFRA2 Polyclonal Antibody |
ABP58634-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human GFRA2 protein at amino acid sequence of 320-400
- Applications tips:
|
Description: A polyclonal antibody for detection of GFRA2 from Human, Mouse. This GFRA2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GFRA2 protein at amino acid sequence of 320-400 |
GFRA2 Polyclonal Antibody |
ABP58634-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GFRA2 protein at amino acid sequence of 320-400
- Applications tips:
|
Description: A polyclonal antibody for detection of GFRA2 from Human, Mouse. This GFRA2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GFRA2 protein at amino acid sequence of 320-400 |
GFRA2 Rabbit pAb |
A2954-100ul |
Abclonal |
100 ul |
EUR 308 |
GFRA2 Rabbit pAb |
A2954-200ul |
Abclonal |
200 ul |
EUR 459 |
GFRA2 Rabbit pAb |
A2954-20ul |
Abclonal |
20 ul |
EUR 183 |
GFRA2 Rabbit pAb |
A2954-50ul |
Abclonal |
50 ul |
EUR 223 |
GFRA2 antibody |
70R-5332 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal GFRA2 antibody raised against the C terminal of GFRA2 |
GFRA2 Antibody |
31206-100ul |
SAB |
100ul |
EUR 252 |
GFRA2 Antibody |
31206-50ul |
SAB |
50ul |
EUR 187 |
GFRA2 antibody |
70R-17467 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal GFRA2 antibody |
GFRA2 Antibody |
1-CSB-PA009380GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: 0.1M NaHCO3, 0.1M Glycine, 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
GFRA2 Antibody |
1-CSB-PA009380LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200 |
GFRA2 Antibody |
1-CSB-PA135383 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000 |
GFRA2 Antibody |
1-CSB-PA150222 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000 |
GFRA2 Conjugated Antibody |
C31206 |
SAB |
100ul |
EUR 397 |
anti- GFRA2 antibody |
FNab03438 |
FN Test |
100µg |
EUR 585 |
- Immunogen: GDNF family receptor alpha 2
- Uniprot ID: O00451
- Gene ID: 2675
- Research Area: Neuroscience
|
Description: Antibody raised against GFRA2 |
anti- GFRA2 antibody |
FNab03439 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: GDNF family receptor alpha 2
- Uniprot ID: O00451
- Gene ID: 2675
- Research Area: Neuroscience
|
Description: Antibody raised against GFRA2 |
Anti-GFRA2 antibody |
STJ23776 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. The protein encoded by this gene is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. This encoded protein acts preferentially as a receptor for NTN compared to its other family member, GDNF family receptor alpha 1. This gene is a candidate gene for RET-associated diseases. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-GFRA2 antibody |
STJ192348 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to GFRA2 |
GFRA2 siRNA |
20-abx917800 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GFRA2 siRNA |
20-abx917801 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GFRA2 Antibody, HRP conjugated |
1-CSB-PA009380LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
GFRA2 Antibody, FITC conjugated |
1-CSB-PA009380LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
GFRA2 Antibody, Biotin conjugated |
1-CSB-PA009380LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
GFRA2 cloning plasmid |
CSB-CL009380HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1395
- Sequence: atgatcttggcaaacgtcttctgcctcttcttctttctagacgagaccctccgctctttggccagcccttcctccctgcagggccccgagctccacggctggcgccccccagtggactgtgtccgggccaatgagctgtgtgccgccgaatccaactgcagctctcgctaccgca
- Show more
|
Description: A cloning plasmid for the GFRA2 gene. |
GFRA2 Blocking Peptide |
33R-6924 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GFRA2 antibody, catalog no. 70R-5332 |
Mouse GFRA2 shRNA Plasmid |
20-abx970520 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human GFRA2 shRNA Plasmid |
20-abx951784 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
GFRA2 Recombinant Protein (Human) |
RP013135 |
ABM |
100 ug |
Ask for price |
GFRA2 Recombinant Protein (Rat) |
RP202517 |
ABM |
100 ug |
Ask for price |
GFRA2 Recombinant Protein (Mouse) |
RP136337 |
ABM |
100 ug |
Ask for price |
GDNF Family Receptor Alpha 2 (GFRA2) Antibody |
20-abx007289 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
GFRA2 Rabbit Polyclonal Antibody