MSMB Rabbit Polyclonal Antibody
MSMB Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
MSMB Polyclonal Antibody |
ABP59329-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MSMB protein
- Applications tips:
|
Description: A polyclonal antibody for detection of MSMB from Human, Mouse, Rat. This MSMB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MSMB protein |
MSMB Polyclonal Antibody |
ABP59329-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MSMB protein
- Applications tips:
|
Description: A polyclonal antibody for detection of MSMB from Human, Mouse, Rat. This MSMB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MSMB protein |
Human Microseminoprotein Beta (MSMb) ELISA Kit |
DLR-MSMb-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Microseminoprotein Beta (MSMb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Microseminoprotein Beta (MSMb) in samples from serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Microseminoprotein Beta (MSMb) ELISA Kit |
DLR-MSMb-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Microseminoprotein Beta (MSMb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Microseminoprotein Beta (MSMb) in samples from serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Microseminoprotein Beta (MSMb) ELISA Kit |
DLR-MSMb-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Microseminoprotein Beta (MSMb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Microseminoprotein Beta (MSMb) in samples from serum, plasma or other biological fluids. |
Mouse Microseminoprotein Beta (MSMb) ELISA Kit |
DLR-MSMb-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Microseminoprotein Beta (MSMb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Microseminoprotein Beta (MSMb) in samples from serum, plasma or other biological fluids. |
Human Microseminoprotein Beta (MSMb) ELISA Kit |
RD-MSMb-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Microseminoprotein Beta (MSMb) ELISA Kit |
RD-MSMb-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Microseminoprotein Beta (MSMb) ELISA Kit |
RD-MSMb-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Microseminoprotein Beta (MSMb) ELISA Kit |
RD-MSMb-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Human Microseminoprotein Beta (MSMb) ELISA Kit |
RDR-MSMb-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Microseminoprotein Beta (MSMb) ELISA Kit |
RDR-MSMb-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Microseminoprotein Beta (MSMb) ELISA Kit |
RDR-MSMb-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Microseminoprotein Beta (MSMb) ELISA Kit |
RDR-MSMb-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
MSMB Rabbit pAb |
A10092-100ul |
Abclonal |
100 ul |
EUR 308 |
MSMB Rabbit pAb |
A10092-200ul |
Abclonal |
200 ul |
EUR 459 |
MSMB Rabbit pAb |
A10092-20ul |
Abclonal |
20 ul |
EUR 183 |
MSMB Rabbit pAb |
A10092-50ul |
Abclonal |
50 ul |
EUR 223 |
MSMB Rabbit mAb |
A4168-100ul |
Abclonal |
100 ul |
EUR 410 |
MSMB Rabbit mAb |
A4168-200ul |
Abclonal |
200 ul |
EUR 571 |
MSMB Rabbit mAb |
A4168-20ul |
Abclonal |
20 ul |
EUR 221 |
MSMB Rabbit mAb |
A4168-50ul |
Abclonal |
50 ul |
EUR 287 |
MSMB Rabbit pAb |
A13625-100ul |
Abclonal |
100 ul |
EUR 308 |
MSMB Rabbit pAb |
A13625-200ul |
Abclonal |
200 ul |
EUR 459 |
MSMB Rabbit pAb |
A13625-20ul |
Abclonal |
20 ul |
EUR 183 |
MSMB Rabbit pAb |
A13625-50ul |
Abclonal |
50 ul |
EUR 223 |
MSMB Antibody |
32522-100ul |
SAB |
100ul |
EUR 252 |
MSMB antibody |
70R-18647 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MSMB antibody |
MSMB Antibody |
DF6720 |
Affbiotech |
200ul |
EUR 304 |
Description: MSMB Antibody detects endogenous levels of total MSMB. |
MSMB Antibody |
1-CSB-PA301850 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
MSMB Antibody |
1-CSB-PA164416 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
MSMB Antibody |
1-CSB-PA015046GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
MSMB Antibody |
1-CSB-PA015046LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human) |
4-PAC628Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Asn19~Ile114)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb) |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse) |
4-PAC628Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Val21-Met113)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb) |
MSMB Conjugated Antibody |
C32522 |
SAB |
100ul |
EUR 397 |
Anti-MSMB antibody |
STJ112132 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the immunoglobulin binding factor family. It is synthesized by the epithelial cells of the prostate gland and secreted into the seminal plasma. This protein has inhibin-like activity. It may have a role as an autocrine paracrine factor in uterine, breast and other female reproductive tissues. The expression of the encoded protein is found to be decreased in prostate cancer. Two alternatively spliced transcript variants encoding different isoforms are described for this gene. The use of alternate polyadenylation sites has been found for this gene. |
Anti-MSMB antibody |
STJ192226 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MSMB |
Anti-MSMB antibody |
STJ115584 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the immunoglobulin binding factor family. It is synthesized by the epithelial cells of the prostate gland and secreted into the seminal plasma. This protein has inhibin-like activity. It may have a role as an autocrine paracrine factor in uterine, breast and other female reproductive tissues. The expression of the encoded protein is found to be decreased in prostate cancer. Two alternatively spliced transcript variants encoding different isoforms are described for this gene. The use of alternate polyadenylation sites has been found for this gene. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), APC |
4-PAC628Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Asn19~Ile114)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with APC. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), Biotinylated |
4-PAC628Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Asn19~Ile114)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with Biotin. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), Cy3 |
4-PAC628Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Asn19~Ile114)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with Cy3. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), FITC |
4-PAC628Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Asn19~Ile114)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with FITC. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), HRP |
4-PAC628Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Asn19~Ile114)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with HRP. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), PE |
4-PAC628Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Asn19~Ile114)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with PE. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), APC |
4-PAC628Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Val21-Met113)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with APC. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), Biotinylated |
4-PAC628Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Val21-Met113)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with Biotin. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), Cy3 |
4-PAC628Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Val21-Met113)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with Cy3. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), FITC |
4-PAC628Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Val21-Met113)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with FITC. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), HRP |
4-PAC628Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Val21-Met113)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with HRP. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), PE |
4-PAC628Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Val21-Met113)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with PE. |
Rabbit Microseminoprotein Beta (MSMb) ELISA Kit |
abx362965-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit β microseminoprotein(MSMB) ELISA kit |
E04B0949-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit β microseminoprotein(MSMB) ELISA kit |
E04B0949-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit β microseminoprotein(MSMB) ELISA kit |
E04B0949-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
MSMB siRNA |
20-abx903360 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MSMB siRNA |
20-abx924797 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MSMB siRNA |
20-abx924798 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Microseminoprotein Beta (MSMB) Antibody |
20-abx113736 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Microseminoprotein Beta (MSMb) Antibody |
20-abx129875 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Microseminoprotein Beta (MSMB) Antibody |
20-abx136010 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Microseminoprotein Beta (MSMb) Antibody |
20-abx102392 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Microseminoprotein Beta (MSMb) Antibody |
20-abx173566 |
Abbexa |
|
|
|
Microseminoprotein Beta (MSMb) Antibody |
20-abx177557 |
Abbexa |
|
|
|
Microseminoprotein Beta (MSMB) Antibody |
20-abx333960 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Microseminoprotein Beta (MSMB) Antibody |
20-abx211136 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Microseminoprotein Beta (MSMB) Antibody |
20-abx211250 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Microseminoprotein Beta (MSMB) Antibody |
20-abx225295 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
MSMB Antibody, HRP conjugated |
1-CSB-PA015046LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
MSMB Antibody, FITC conjugated |
1-CSB-PA015046LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
MSMB Antibody, Biotin conjugated |
1-CSB-PA015046LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-MSMB Monoclonal Antibody |
M03041 |
BosterBio |
100ug |
EUR 397 |
Description: Rabbit Monoclonal MSMB Antibody. Validated in IP, WB and tested in Human. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC628Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Asn19~Ile114)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with APC-Cy7. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAC628Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Val21-Met113)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with APC-Cy7. |
MSMB cloning plasmid |
CSB-CL015046HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 345
- Sequence: atgaatgttctcctgggcagcgttgtgatctttgccaccttcgtgactttatgcaatgcatcatgctatttcatacctaatgagggagttccaggagattcaaccaggaaatgcatggatctcaaaggaaacaaacacccaataaactcggagtggcagactgacaactgtgagac
- Show more
|
Description: A cloning plasmid for the MSMB gene. |
MSMB Blocking Peptide |
DF6720-BP |
Affbiotech |
1mg |
EUR 195 |
Microseminoprotein Beta (MSMb) Antibody (FITC) |
20-abx273626 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Microseminoprotein Beta (MSMb) Antibody Pair |
20-abx370275 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Microseminoprotein Beta (MSMB) Antibody (HRP) |
20-abx334839 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Microseminoprotein Beta (MSMB) Antibody (FITC) |
20-abx334840 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Microseminoprotein Beta (MSMB) Antibody (Biotin) |
20-abx334841 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Microseminoprotein Beta (MSMb) Antibody (Biotin) |
20-abx272286 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Rat MSMB shRNA Plasmid |
20-abx985418 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Microseminoprotein Beta (MSMB) Protein |
20-abx263042 |
Abbexa |
-
EUR 328.00
-
EUR 7358.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Human MSMB shRNA Plasmid |
20-abx952973 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse MSMB shRNA Plasmid |
20-abx971579 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Recombinant Microseminoprotein Beta (MSMb) |
4-RPC628Hu01 |
Cloud-Clone |
-
EUR 458.40
-
EUR 226.00
-
EUR 1444.00
-
EUR 548.00
-
EUR 996.00
-
EUR 370.00
-
EUR 3460.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P08118
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 16.7kDa
- Isoelectric Point: 5.6
|
Description: Recombinant Human Microseminoprotein Beta expressed in: E.coli |
Recombinant Microseminoprotein Beta (MSMb) |
4-RPC628Mu01 |
Cloud-Clone |
-
EUR 499.62
-
EUR 236.00
-
EUR 1598.56
-
EUR 599.52
-
EUR 1099.04
-
EUR 397.00
-
EUR 3846.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O08540
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 40.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Microseminoprotein Beta expressed in: E.coli |
MSMB Recombinant Protein (Human) |
RP020176 |
ABM |
100 ug |
Ask for price |
MSMB Recombinant Protein (Rat) |
RP212564 |
ABM |
100 ug |
Ask for price |
MSMB Recombinant Protein (Mouse) |
RP151835 |
ABM |
100 ug |
Ask for price |
Human Microseminoprotein Beta (MSMb) Protein |
20-abx068011 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Mouse Microseminoprotein Beta (MSMb) Protein |
20-abx167381 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2151.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
MSMB ORF Vector (Human) (pORF) |
ORF006726 |
ABM |
1.0 ug DNA |
EUR 95 |
Msmb ORF Vector (Mouse) (pORF) |
ORF050613 |
ABM |
1.0 ug DNA |
EUR 506 |
Msmb ORF Vector (Rat) (pORF) |
ORF070856 |
ABM |
1.0 ug DNA |
EUR 506 |
MSMB ELISA Kit (Human) (OKCD00344) |
OKCD00344 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.065ng/m |
MSMB ELISA Kit (Mouse) (OKCD02734) |
OKCD02734 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.072 ng/mL |
MSMB ELISA Kit (Monkey) (OKCA01603) |
OKCA01603 |
Aviva Systems Biology |
96 Wells |
EUR 930 |
Description: Description of target: ;Species reactivity: Monkey;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.195 ug/mL |
MSMB ELISA Kit (Rat) (OKEH05993) |
OKEH05993 |
Aviva Systems Biology |
96 Wells |
EUR 727 |
Description: Description of target: small protein found in secretions on mucosal surfaces [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.161 ng/mL |
MSMB ELISA Kit (Mouse) (OKEH07071) |
OKEH07071 |
Aviva Systems Biology |
96 Wells |
EUR 727 |
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.16 ng/mL |
Pig Beta-Microseminoprotein (MSMB) ELISA Kit |
abx520327-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Beta-Microseminoprotein (MSMB) ELISA Kit |
abx520328-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Pig Microseminoprotein Beta (MSMb) ELISA Kit |
abx361087-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Microseminoprotein Beta (MSMb) ELISA Kit |
abx364138-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Mouse Beta-Microseminoprotein (MSMB) ELISA Kit |
abx571578-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Beta-Microseminoprotein (MSMB) ELISA Kit |
abx574902-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Msmb/ Beta-microseminoprotein ELISA Kit |
E0637Ra |
Sunlong |
1 Kit |
EUR 646 |
Goat β microseminoprotein(MSMB) ELISA kit |
E06B0949-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat β microseminoprotein(MSMB) ELISA kit |
E06B0949-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat β microseminoprotein(MSMB) ELISA kit |
E06B0949-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat β microseminoprotein(MSMB) ELISA kit |
E02B0949-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat β microseminoprotein(MSMB) ELISA kit |
E02B0949-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat β microseminoprotein(MSMB) ELISA kit |
E02B0949-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human β microseminoprotein(MSMB) ELISA kit |
E01B0949-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human β microseminoprotein(MSMB) ELISA kit |
E01B0949-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human β microseminoprotein(MSMB) ELISA kit |
E01B0949-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β microseminoprotein(MSMB) ELISA kit |
E03B0949-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β microseminoprotein(MSMB) ELISA kit |
E03B0949-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β microseminoprotein(MSMB) ELISA kit |
E03B0949-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig β microseminoprotein(MSMB) ELISA kit |
E07B0949-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig β microseminoprotein(MSMB) ELISA kit |
E07B0949-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig β microseminoprotein(MSMB) ELISA kit |
E07B0949-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey β microseminoprotein(MSMB) ELISA kit |
E09B0949-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey β microseminoprotein(MSMB) ELISA kit |
E09B0949-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey β microseminoprotein(MSMB) ELISA kit |
E09B0949-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog β microseminoprotein(MSMB) ELISA kit |
E08B0949-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog β microseminoprotein(MSMB) ELISA kit |
E08B0949-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog β microseminoprotein(MSMB) ELISA kit |
E08B0949-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Msmb/ Beta-microseminoprotein ELISA Kit |
E0972Mo |
Sunlong |
1 Kit |
EUR 632 |
Human MSMB/ Beta-microseminoprotein ELISA Kit |
E1638Hu |
Sunlong |
1 Kit |
EUR 605 |
Human MSMB(Beta-microseminoprotein) ELISA Kit |
EH2282 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 15.625-1000 pg/ml
- Uniprot ID: P08118
- Alias: MSMB/PSP94/IGBF/MSPB/PIP/PN44/PRPS/PSP57
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml |
Porcine Beta- microseminoprotein, MSMB ELISA KIT |
ELI-07504p |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Beta- microseminoprotein, Msmb ELISA KIT |
ELI-07505m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Beta- microseminoprotein, MSMB ELISA KIT |
ELI-07506h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Microseminoprotein beta (MSMb) ELISA Kit |
20-abx154407 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Microseminoprotein beta (MSMb) ELISA Kit |
20-abx152383 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Chicken Microseminoprotein Beta (MSMb) ELISA Kit |
abx356068-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Microseminoprotein Beta (MSMb) ELISA Kit |
abx359299-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Microseminoprotein beta (MSMb) CLIA Kit |
20-abx493807 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Microseminoprotein beta (MSMb) CLIA Kit |
20-abx493808 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Microseminoprotein Beta (MSMb) ELISA Kit |
abx251632-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Human Microseminoprotein Beta (MSMb) CLIA Kit |
abx197287-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Msmb sgRNA CRISPR Lentivector set (Mouse) |
K3408701 |
ABM |
3 x 1.0 ug |
EUR 339 |
MSMB sgRNA CRISPR Lentivector set (Human) |
K1350001 |
ABM |
3 x 1.0 ug |
EUR 339 |
MSMB Rabbit Polyclonal Antibody