WNT2 Rabbit Polyclonal Antibody
WNT2 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
WNT2 Polyclonal Antibody |
ABP60923-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human WNT2 protein at amino acid sequence of 200-280
- Applications tips:
|
Description: A polyclonal antibody for detection of WNT2 from Human, Mouse. This WNT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WNT2 protein at amino acid sequence of 200-280 |
WNT2 Polyclonal Antibody |
ABP60923-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human WNT2 protein at amino acid sequence of 200-280
- Applications tips:
|
Description: A polyclonal antibody for detection of WNT2 from Human, Mouse. This WNT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WNT2 protein at amino acid sequence of 200-280 |
WNT2 Polyclonal Antibody |
ABP60923-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human WNT2 protein at amino acid sequence of 200-280
- Applications tips:
|
Description: A polyclonal antibody for detection of WNT2 from Human, Mouse. This WNT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WNT2 protein at amino acid sequence of 200-280 |
WNT2 Rabbit pAb |
A5864-100ul |
Abclonal |
100 ul |
EUR 308 |
WNT2 Rabbit pAb |
A5864-200ul |
Abclonal |
200 ul |
EUR 459 |
WNT2 Rabbit pAb |
A5864-20ul |
Abclonal |
20 ul |
EUR 183 |
WNT2 Rabbit pAb |
A5864-50ul |
Abclonal |
50 ul |
EUR 223 |
WNT2 Rabbit pAb |
A13562-100ul |
Abclonal |
100 ul |
EUR 308 |
WNT2 Rabbit pAb |
A13562-200ul |
Abclonal |
200 ul |
EUR 459 |
WNT2 Rabbit pAb |
A13562-20ul |
Abclonal |
20 ul |
EUR 183 |
WNT2 Rabbit pAb |
A13562-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-WNT2 Rabbit Monoclonal Antibody |
M03226 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal WNT2 Antibody. Validated in WB and tested in Human, Mouse, Rat. |
WNT2 antibody |
70R-5380 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal WNT2 antibody raised against the middle region of WNT2 |
WNT2 antibody |
70R-21324 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal WNT2 antibody |
WNT2 antibody |
38699-100ul |
SAB |
100ul |
EUR 252 |
WNT2 Antibody |
43192-100ul |
SAB |
100ul |
EUR 252 |
Wnt2 antibody |
70R-11919 |
Fitzgerald |
100 ug |
EUR 460 |
Description: Rabbit polyclonal Wnt2 antibody |
WNT2 Antibody |
DF8067 |
Affbiotech |
200ul |
EUR 304 |
Description: WNT2 Antibody detects endogenous levels of total WNT2. |
WNT2 Antibody |
1-CSB-PA780157 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against WNT2. Recognizes WNT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
WNT2 Antibody |
1-CSB-PA782193 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against WNT2. Recognizes WNT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:30-1:150 |
WNT2 Antibody |
1-CSB-PA026133ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against WNT2. Recognizes WNT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200 |
WNT2 Antibody |
1-CSB-PA026133GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against WNT2. Recognizes WNT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit |
DLR-WNT2-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit |
DLR-WNT2-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit |
RDR-WNT2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit |
RDR-WNT2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit |
RD-WNT2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit |
RD-WNT2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Polyclonal Wnt2 antibody - C-terminal region |
APR00601G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Wnt2 - C-terminal region. This antibody is tested and proven to work in the following applications: |
WNT2 Conjugated Antibody |
C38699 |
SAB |
100ul |
EUR 397 |
WNT2 Conjugated Antibody |
C43192 |
SAB |
100ul |
EUR 397 |
anti- WNT2 antibody |
FNab09517 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: wingless-type MMTV integration site family member 2
- Uniprot ID: P09544
- Gene ID: 7472
- Research Area: Cardiovascular, Developmental biology, Signal Transduction
|
Description: Antibody raised against WNT2 |
Anti-Wnt2 Antibody |
PB9461 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-WNT2 antibody |
STJ28427 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the WNT gene family. The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Alternatively spliced transcript variants have been identified for this gene. |
Anti-WNT2 antibody |
STJ115523 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the WNT gene family. The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Alternatively spliced transcript variants have been identified for this gene. |
Anti-WNT2 antibody |
STJ192458 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to WNT2 |
WNT2 siRNA |
20-abx939891 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
WNT2 siRNA |
20-abx939892 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
WNT2 cloning plasmid |
CSB-CL026133HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1083
- Sequence: atgaacgcccctctcggtggaatctggctctggctccctctgctcttgacctggctcacccccgaggtcaactcttcatggtggtacatgagagctacaggtggctcctccagggtgatgtgcgataatgtgccaggcctggtgagcagccagcggcagctgtgtcaccgacatc
- Show more
|
Description: A cloning plasmid for the WNT2 gene. |
WNT2 Blocking Peptide |
33R-3548 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of WNT2 antibody, catalog no. 70R-5380 |
Wnt2 Blocking Peptide |
33R-10810 |
Fitzgerald |
50 ug |
EUR 191 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Wnt2 antibody, catalog no. 70R-11919 |
WNT2 Blocking Peptide |
DF8067-BP |
Affbiotech |
1mg |
EUR 195 |
Protein Wnt-2 (WNT2) Antibody |
abx122394-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Protein Wnt-2 (WNT2) Antibody |
20-abx004501 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Protein Wnt-2 (WNT2) Antibody |
20-abx321679 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protein Wnt-2 (WNT2) Antibody |
abx219361-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Protein Wnt-2 (WNT2) Antibody |
abx239517-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Wnt Family Member 2 (WNT2) Antibody |
20-abx212817 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Wnt Family Member 2 (WNT2) Antibody |
20-abx213286 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human WNT2 shRNA Plasmid |
20-abx955111 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse WNT2 shRNA Plasmid |
20-abx973403 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
WNT2 Recombinant Protein (Human) |
RP034819 |
ABM |
100 ug |
Ask for price |
WNT2 Recombinant Protein (Mouse) |
RP185666 |
ABM |
100 ug |
Ask for price |
Human Protein Wnt-2 (WNT2) |
1-CSB-YP026133HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 39.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Protein Wnt-2(WNT2) expressed in Yeast |
Human Protein Wnt-2 (WNT2) |
1-CSB-EP026133HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 41.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Protein Wnt-2(WNT2) expressed in E.coli |
WNT2 ORF Vector (Human) (pORF) |
ORF011607 |
ABM |
1.0 ug DNA |
EUR 95 |
Wnt2 ORF Vector (Mouse) (pORF) |
ORF061890 |
ABM |
1.0 ug DNA |
EUR 506 |
WNT2 ELISA Kit (Mouse) (OKCA02439) |
OKCA02439 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Ligand for members of the frizzled family of seven transmembrane receptors. Probable developmental protein. May be a signaling molecule which affects the development of discrete regions of tissues. Is likely to signal over only few cell diameters. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 3.9 pg/mL |
WNT2 ELISA Kit (Mouse) (OKEH05141) |
OKEH05141 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Ligand for members of the frizzled family of seven transmembrane receptors. Probable developmental protein. May be a signaling molecule which affects the development of discrete regions of tissues. Is likely to signal over only few cell diameters. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089 ng/mL |
Wingless Type MMTV Integration Site Family, Member 2 (WNT2) Polyclonal Antibody (Human) |
4-PAL820Hu01 |
Cloud-Clone |
-
EUR 262.00
-
EUR 2747.00
-
EUR 679.00
-
EUR 331.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: WNT2 (Ser26~Thr360)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) |
WNT2 sgRNA CRISPR Lentivector set (Human) |
K2641601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Wnt2 sgRNA CRISPR Lentivector set (Mouse) |
K3934701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Wingless Type MMTV Integration Site Family, Member 2 (WNT2) Polyclonal Antibody (Human), APC |
4-PAL820Hu01-APC |
Cloud-Clone |
-
EUR 368.00
-
EUR 3599.00
-
EUR 993.00
-
EUR 472.00
-
EUR 229.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: WNT2 (Ser26~Thr360)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2). This antibody is labeled with APC. |
Wingless Type MMTV Integration Site Family, Member 2 (WNT2) Polyclonal Antibody (Human), Biotinylated |
4-PAL820Hu01-Biotin |
Cloud-Clone |
-
EUR 328.00
-
EUR 2697.00
-
EUR 786.00
-
EUR 404.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: WNT2 (Ser26~Thr360)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2). This antibody is labeled with Biotin. |
Wingless Type MMTV Integration Site Family, Member 2 (WNT2) Polyclonal Antibody (Human), Cy3 |
4-PAL820Hu01-Cy3 |
Cloud-Clone |
-
EUR 449.00
-
EUR 4757.00
-
EUR 1283.00
-
EUR 588.00
-
EUR 264.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: WNT2 (Ser26~Thr360)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2). This antibody is labeled with Cy3. |
Wingless Type MMTV Integration Site Family, Member 2 (WNT2) Polyclonal Antibody (Human), FITC |
4-PAL820Hu01-FITC |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: WNT2 (Ser26~Thr360)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2). This antibody is labeled with FITC. |
Wingless Type MMTV Integration Site Family, Member 2 (WNT2) Polyclonal Antibody (Human), HRP |
4-PAL820Hu01-HRP |
Cloud-Clone |
-
EUR 335.00
-
EUR 3135.00
-
EUR 877.00
-
EUR 426.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: WNT2 (Ser26~Thr360)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2). This antibody is labeled with HRP. |
Wingless Type MMTV Integration Site Family, Member 2 (WNT2) Polyclonal Antibody (Human), PE |
4-PAL820Hu01-PE |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: WNT2 (Ser26~Thr360)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2). This antibody is labeled with PE. |
Wingless Type MMTV Integration Site Family, Member 2 (WNT2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAL820Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 616.00
-
EUR 7078.00
-
EUR 1867.00
-
EUR 824.00
-
EUR 338.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: WNT2 (Ser26~Thr360)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2). This antibody is labeled with APC-Cy7. |
Cow Protein Wnt-2 (WNT2) ELISA Kit |
abx520188-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Protein Wnt-2 (WNT2) ELISA Kit |
abx520190-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Wnt2/ Protein Wnt-2 ELISA Kit |
E1593Mo |
Sunlong |
1 Kit |
EUR 571 |
Human WNT2/ Protein Wnt-2 ELISA Kit |
E2686Hu |
Sunlong |
1 Kit |
EUR 571 |
Human WNT2(Protein Wnt-2) ELISA Kit |
EH2251 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P09544
- Alias: WNT2/NT1L1/IRP/Int-1-like protein 1/Int-1-related protein/secreted growth factor/Int-1-like protein 1/Int-1-related protein/IRPprotein Wnt-2/wingless-type MMTV integration site family member 2
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Protein Wnt-2 (WNT2) ELISA Kit |
abx251598-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
WNT2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2641602 |
ABM |
1.0 ug DNA |
EUR 154 |
WNT2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2641603 |
ABM |
1.0 ug DNA |
EUR 154 |
WNT2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2641604 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Protein Wnt-2(WNT2) ELISA kit |
CSB-EL026133HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Protein Wnt-2 (WNT2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Protein Wnt-2(WNT2) ELISA kit |
1-CSB-EL026133HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Protein Wnt-2(WNT2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Protein Wnt-2(WNT2) ELISA kit |
CSB-EL026133MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein Wnt-2 (WNT2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Protein Wnt-2(WNT2) ELISA kit |
1-CSB-EL026133MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein Wnt-2(WNT2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Wnt2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3934702 |
ABM |
1.0 ug DNA |
EUR 154 |
Wnt2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3934703 |
ABM |
1.0 ug DNA |
EUR 154 |
Wnt2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3934704 |
ABM |
1.0 ug DNA |
EUR 154 |
WNT2 Protein Vector (Human) (pPB-C-His) |
PV046425 |
ABM |
500 ng |
EUR 329 |
WNT2 Protein Vector (Human) (pPB-N-His) |
PV046426 |
ABM |
500 ng |
EUR 329 |
WNT2 Protein Vector (Human) (pPM-C-HA) |
PV046427 |
ABM |
500 ng |
EUR 329 |
WNT2 Protein Vector (Human) (pPM-C-His) |
PV046428 |
ABM |
500 ng |
EUR 329 |
WNT2 Protein Vector (Mouse) (pPB-C-His) |
PV247558 |
ABM |
500 ng |
EUR 603 |
WNT2 Protein Vector (Mouse) (pPB-N-His) |
PV247559 |
ABM |
500 ng |
EUR 603 |
WNT2 Protein Vector (Mouse) (pPM-C-HA) |
PV247560 |
ABM |
500 ng |
EUR 603 |
WNT2 Protein Vector (Mouse) (pPM-C-His) |
PV247561 |
ABM |
500 ng |
EUR 603 |
Wnt2 3'UTR GFP Stable Cell Line |
TU172326 |
ABM |
1.0 ml |
Ask for price |
WNT2 3'UTR GFP Stable Cell Line |
TU078510 |
ABM |
1.0 ml |
EUR 1521 |
Wnt2 3'UTR Luciferase Stable Cell Line |
TU122326 |
ABM |
1.0 ml |
Ask for price |
WNT2 3'UTR Luciferase Stable Cell Line |
TU028510 |
ABM |
1.0 ml |
EUR 1521 |
Wnt2 3'UTR Luciferase Stable Cell Line |
TU223426 |
ABM |
1.0 ml |
Ask for price |
Wnt2 3'UTR GFP Stable Cell Line |
TU273426 |
ABM |
1.0 ml |
Ask for price |
WNT2 ELISA Kit (Human) : 96 Wells (OKEH01684) |
OKEH01684 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene is a member of the WNT gene family. The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Alternatively spliced transcript variants have been identified for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098 ng/mL |
Wingless-Type Mmtv Integration Site Family Member 2 (WNT2) Antibody |
20-abx116672 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Wingless Type MMTV Integration Site Family, Member 2 (WNT2) Antibody |
20-abx128886 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Wingless Type MMTV Integration Site Family, Member 2 (WNT2) Antibody |
20-abx175133 |
Abbexa |
|
|
|
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WNT2 Rabbit Polyclonal Antibody