LDB3 Rabbit Polyclonal Antibody
LDB3 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
LDB3 Polyclonal Antibody |
30932-50ul |
SAB |
50ul |
EUR 187 |
LDB3 Polyclonal Antibody |
ABP59101-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human LDB3 protein at amino acid sequence of 41-90
- Applications tips:
|
Description: A polyclonal antibody for detection of LDB3 from Human, Mouse. This LDB3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LDB3 protein at amino acid sequence of 41-90 |
LDB3 Polyclonal Antibody |
ABP59101-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human LDB3 protein at amino acid sequence of 41-90
- Applications tips:
|
Description: A polyclonal antibody for detection of LDB3 from Human, Mouse. This LDB3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LDB3 protein at amino acid sequence of 41-90 |
LDB3 Polyclonal Antibody |
ABP59101-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human LDB3 protein at amino acid sequence of 41-90
- Applications tips:
|
Description: A polyclonal antibody for detection of LDB3 from Human, Mouse. This LDB3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LDB3 protein at amino acid sequence of 41-90 |
LDB3 Polyclonal Antibody |
ES11419-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against LDB3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
LDB3 Polyclonal Antibody |
ES11419-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against LDB3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
LDB3 Rabbit pAb |
A7462-100ul |
Abclonal |
100 ul |
EUR 308 |
LDB3 Rabbit pAb |
A7462-200ul |
Abclonal |
200 ul |
EUR 459 |
LDB3 Rabbit pAb |
A7462-20ul |
Abclonal |
20 ul |
EUR 183 |
LDB3 Rabbit pAb |
A7462-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal LDB3 Antibody (Center) |
APR17180G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LDB3 (Center). This antibody is tested and proven to work in the following applications: |
LDB3 Polyclonal Conjugated Antibody |
C30932 |
SAB |
100ul |
EUR 397 |
LDB3 antibody |
70R-18235 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal LDB3 antibody |
LDB3 antibody |
70R-1141 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal LDB3 antibody raised against the N terminal of LDB3 |
LDB3 Antibody |
DF12652 |
Affbiotech |
200ul |
EUR 304 |
Description: LDB3 Antibody detects endogenous levels of LDB3. |
LDB3 Antibody |
1-CSB-PA012831ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against LDB3. Recognizes LDB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
LDB3 Antibody |
1-CSB-PA012831ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against LDB3. Recognizes LDB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
LDB3 Antibody |
1-CSB-PA012831GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against LDB3. Recognizes LDB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Polyclonal LDB3 Antibody (N-term) |
APR17183G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LDB3 (N-term). This antibody is tested and proven to work in the following applications: |
anti- LDB3 antibody |
FNab04734 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: LIM domain binding 3
- Uniprot ID: O75112
- Gene ID: 11155
- Research Area: Developmental biology
|
Description: Antibody raised against LDB3 |
Anti-LDB3 antibody |
STJ29598 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a PDZ domain-containing protein. PDZ motifs are modular protein-protein interaction domains consisting of 80-120 amino acid residues. PDZ domain-containing proteins interact with each other in cytoskeletal assembly or with other proteins involved in targeting and clustering of membrane proteins. The protein encoded by this gene interacts with alpha-actinin-2 through its N-terminal PDZ domain and with protein kinase C via its C-terminal LIM domains. The LIM domain is a cysteine-rich motif defined by 50-60 amino acids containing two zinc-binding modules. This protein also interacts with all three members of the myozenin family. Mutations in this gene have been associated with myofibrillar myopathy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been identified; all isoforms have N-terminal PDZ domains while only longer isoforms (1, 2 and 5) have C-terminal LIM domains. |
Anti-LDB3 antibody |
STJ192577 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to LDB3 |
LDB3 siRNA |
20-abx922381 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LDB3 siRNA |
20-abx922382 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-LDB3 |
YF-PA17478 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to LDB3 |
anti-LDB3 |
YF-PA27498 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to LDB3 |
Polyclonal Goat Anti-ZASP/ CYPHER / LDB3 Antibody |
APR16432G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ZASP/ CYPHER / LDB3 . This antibody is tested and proven to work in the following applications: |
LDB3 Blocking Peptide |
33R-7412 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LDB3 antibody, catalog no. 70R-1141 |
LDB3 Blocking Peptide |
DF12652-BP |
Affbiotech |
1mg |
EUR 195 |
LDB3 cloning plasmid |
CSB-CL012831HU-10ug |
Cusabio |
10ug |
EUR 348 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 852
- Sequence: atgtcttacagtgtgaccctgactgggcccgggccctggggcttccgtctgcaggggggcaaggacttcaacatgcccctcactatctcccggatcacaccaggcagcaaggcagcccagtcccagctcagccagggtgacctcgtggtggccattgacggcgtcaacacagacac
- Show more
|
Description: A cloning plasmid for the LDB3 gene. |
Anti-LDB3 (2C1) |
YF-MA17645 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to LDB3 |
Anti-LDB3 (3C8) |
YF-MA17646 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse monoclonal to LDB3 |
Anti-LDB3 (3C8) |
YF-MA17647 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to LDB3 |
LDB3 Rabbit Polyclonal Antibody