HAND2 Rabbit Polyclonal Antibody

HAND2 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

HAND2 Polyclonal Antibody

ABP58744-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HAND2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of HAND2 from Human, Mouse, Rat. This HAND2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HAND2 protein

HAND2 Polyclonal Antibody

ABP58744-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HAND2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of HAND2 from Human, Mouse, Rat. This HAND2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HAND2 protein

HAND2 Polyclonal Antibody

30800-100ul 100ul
EUR 252

HAND2 Polyclonal Antibody

30800-50ul 50ul
EUR 187

HAND2 Rabbit pAb

A7044-100ul 100 ul
EUR 308

HAND2 Rabbit pAb

A7044-200ul 200 ul
EUR 459

HAND2 Rabbit pAb

A7044-20ul 20 ul
EUR 183

HAND2 Rabbit pAb

A7044-50ul 50 ul
EUR 223

HAND2 Polyclonal Conjugated Antibody

C30800 100ul
EUR 397

Hand2 antibody

70R-7837 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Hand2 antibody

HAND2 antibody

10R-1600 100 ug
EUR 512
Description: Mouse monoclonal HAND2 antibody

HAND2 Antibody

1-CSB-PA010126ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against HAND2. Recognizes HAND2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal DHAND / HAND2 Antibody (aa194-207)

APR11718G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DHAND / HAND2 (aa194-207). This antibody is tested and proven to work in the following applications:

Polyclonal Hand2 antibody - C-terminal region

AMM06000G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Hand2 - C-terminal region. This antibody is tested and proven to work in the following applications:

Anti-HAND2 Antibody

STJ501310 100 µg
EUR 476

Anti-HAND2 antibody

STJ29124 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the basic helix-loop-helix family of transcription factors. This gene product is one of two closely related family members, the HAND proteins, which are asymmetrically expressed in the developing ventricular chambers and play an essential role in cardiac morphogenesis. Working in a complementary fashion, they function in the formation of the right ventricle and aortic arch arteries, implicating them as mediators of congenital heart disease. In addition, this transcription factor plays an important role in limb and branchial arch development.

Anti-HAND2 antibody

STJ192196 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HAND2

Hand2/ Rat Hand2 ELISA Kit

ELI-27735r 96 Tests
EUR 886

HAND2 siRNA

20-abx902408
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HAND2 siRNA

20-abx919065
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HAND2 siRNA

20-abx919066
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-HAND2 Antibody BIOTIN

STJ501311 100 µg
EUR 586

Anti-HAND2 Antibody FITC

STJ501312 100 µg
EUR 586

Anti-Hand2 (zebrafish) antibody

STJ71256 100 µg
EUR 260

HAND2 cloning plasmid

CSB-CL010126HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 543
  • Sequence: ATGAGTCTGGTAGGTGGTTTTCCCCACCACCCGGTGGTGCACCACGAGGGCTACCCGTTTGCCGCCGCCGCCGCCGCCAGCCGCTGCAGCCATGAGGAGAACCCCTACTTCCATGGCTGGCTCATCGGCCACCCCGAGATGTCGCCCCCCGACTACAGCATGGCCCTGTCCTACAG
  • Show more
Description: A cloning plasmid for the HAND2 gene.

Hand2 Blocking Peptide

33R-2133 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Hand2 antibody, catalog no. 70R-7837

Anti-HAND2 (4D11)

YF-MA16846 100 ug
EUR 363
Description: Mouse monoclonal to HAND2

Anti-HAND2 (3E3)

YF-MA16847 100 ug
EUR 363
Description: Mouse monoclonal to HAND2

Anti-HAND2 (4E12)

YF-MA16848 100 ug
EUR 363
Description: Mouse monoclonal to HAND2

Anti-HAND2 (4D9)

YF-MA16849 100 ug
EUR 363
Description: Mouse monoclonal to HAND2

Anti-HAND2 (3D5)

YF-MA16850 100 ug
EUR 363
Description: Mouse monoclonal to HAND2

Anti-HAND2 (1C7)

YF-MA16851 100 ug
EUR 363
Description: Mouse monoclonal to HAND2

Anti-HAND2 (4B11)

YF-MA16852 100 ug
EUR 363
Description: Mouse monoclonal to HAND2

Anti-HAND2 (2C10)

YF-MA16853 100 ug
EUR 363
Description: Mouse monoclonal to HAND2

Anti-HAND2 (3F10)

YF-MA16854 100 ug
EUR 363
Description: Mouse monoclonal to HAND2

Anti-HAND2 (4H8)

YF-MA11179 100 ug
EUR 363
Description: Mouse monoclonal to HAND2

Rat HAND2 shRNA Plasmid

20-abx986324
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HAND2 ELISA KIT

ELI-19231h 96 Tests
EUR 824

Mouse Hand2 ELISA KIT

ELI-19232m 96 Tests
EUR 865

Chicken HAND2 ELISA KIT

ELI-08810c 96 Tests
EUR 928

HAND2 ELISA KIT|Human

EF005082 96 Tests
EUR 689

Human HAND2 shRNA Plasmid

20-abx956279
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse HAND2 shRNA Plasmid

20-abx970746
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HAND2 Recombinant Protein (Human)

RP039712 100 ug Ask for price

pcDNA3.1-HA-HAND2 Plasmid

PVTB00114-2a 2 ug
EUR 356

pECMV-3-FLAG-HAND2

PVT13397 2 ug
EUR 599

HAND2 Recombinant Protein (Rat)

RP204176 100 ug Ask for price

HAND2 Recombinant Protein (Mouse)

RP140897 100 ug Ask for price

Heart and neural crest derivatives expressed 2 (HAND2) polyclonal antibody

ABP-PAB-10481 100 ug Ask for price
    • Product line: Genetic Disease Markers
    • Brand:

Monoclonal HAND2 Antibody (monoclonal) (M06), Clone: 3D5

APG03379G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human HAND2 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 3D5. This antibody is applicable in WB

Monoclonal HAND2 Antibody (monoclonal) (M05), Clone: 4D9

APR12324G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human HAND2 (monoclonal) (M05). The antibodies are raised in mouse and are from clone 4D9. This antibody is applicable in WB and IF

Hand2 ORF Vector (Rat) (pORF)

ORF068060 1.0 ug DNA
EUR 506

Hand2 ORF Vector (Mouse) (pORF)

ORF046967 1.0 ug DNA
EUR 506

HAND2 ORF Vector (Human) (pORF)

ORF013238 1.0 ug DNA
EUR 95

pCR-BluntII-TOPO-HAND2 Plasmid

PVTB00244S 2 ug
EUR 356

pECMV-Hand2-m-FLAG Plasmid

PVT15424 2 ug
EUR 325

HAND2 ELISA Kit (Human) (OKCD01870)

OKCD01870 96 Wells
EUR 831
Description: Description of target: Essential for cardiac morphogenesis, particularly for the formation of the right ventricle and of the aortic arch arteries. Required for vascular development and regulation of angiogenesis, possibly through a VEGF signaling pathway. Plays also an important role in limb development, particularly in the establishment of anterior-posterior polarization, acting as an upstream regulator of sonic hedgehog (SHH) induction in the limb bud. Is involved in the development of branchial arches, which give rise to unique structures in the head and neck. Binds DNA on E-box consensus sequence 5'-CANNTG-3'.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.054 ng/mL

HAND2 sgRNA CRISPR Lentivector set (Human)

K0928401 3 x 1.0 ug
EUR 339

Hand2 sgRNA CRISPR Lentivector set (Mouse)

K3919401 3 x 1.0 ug
EUR 339

Hand2 sgRNA CRISPR Lentivector set (Rat)

K7606701 3 x 1.0 ug
EUR 339

HAND2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0928402 1.0 ug DNA
EUR 154

HAND2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0928403 1.0 ug DNA
EUR 154

HAND2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0928404 1.0 ug DNA
EUR 154

Hand2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3919402 1.0 ug DNA
EUR 154

Hand2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3919403 1.0 ug DNA
EUR 154

Hand2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3919404 1.0 ug DNA
EUR 154

Hand2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7606702 1.0 ug DNA
EUR 154

Hand2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7606703 1.0 ug DNA
EUR 154

Hand2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7606704 1.0 ug DNA
EUR 154

HAND2 Protein Vector (Human) (pPB-C-His)

PV052949 500 ng
EUR 481

HAND2 Protein Vector (Human) (pPB-N-His)

PV052950 500 ng
EUR 481

HAND2 Protein Vector (Human) (pPM-C-HA)

PV052951 500 ng
EUR 481

HAND2 Protein Vector (Human) (pPM-C-His)

PV052952 500 ng
EUR 481

HAND2 Protein Vector (Rat) (pPB-C-His)

PV272238 500 ng
EUR 603

HAND2 Protein Vector (Rat) (pPB-N-His)

PV272239 500 ng
EUR 603

HAND2 Protein Vector (Rat) (pPM-C-HA)

PV272240 500 ng
EUR 603

HAND2 Protein Vector (Rat) (pPM-C-His)

PV272241 500 ng
EUR 603

Recombinant Human HAND2 Protein, GST, E.coli-100ug

QP6142-ec-100ug 100ug
EUR 571

Recombinant Human HAND2 Protein, GST, E.coli-10ug

QP6142-ec-10ug 10ug
EUR 272

Recombinant Human HAND2 Protein, GST, E.coli-1mg

QP6142-ec-1mg 1mg
EUR 2303

Recombinant Human HAND2 Protein, GST, E.coli-200ug

QP6142-ec-200ug 200ug
EUR 898

Recombinant Human HAND2 Protein, GST, E.coli-500ug

QP6142-ec-500ug 500ug
EUR 1514

Recombinant Human HAND2 Protein, GST, E.coli-50ug

QP6142-ec-50ug 50ug
EUR 362

HAND2 Protein Vector (Mouse) (pPB-C-His)

PV187866 500 ng
EUR 603

HAND2 Protein Vector (Mouse) (pPB-N-His)

PV187867 500 ng
EUR 603

HAND2 Protein Vector (Mouse) (pPM-C-HA)

PV187868 500 ng
EUR 603

HAND2 Protein Vector (Mouse) (pPM-C-His)

PV187869 500 ng
EUR 603

Hand2 3'UTR Luciferase Stable Cell Line

TU205628 1.0 ml Ask for price

Hand2 3'UTR GFP Stable Cell Line

TU159349 1.0 ml Ask for price

HAND2 3'UTR Luciferase Stable Cell Line

TU009547 1.0 ml
EUR 1394

Hand2 3'UTR Luciferase Stable Cell Line

TU109349 1.0 ml Ask for price

HAND2 3'UTR GFP Stable Cell Line

TU059547 1.0 ml
EUR 1394

Hand2 3'UTR GFP Stable Cell Line

TU255628 1.0 ml Ask for price

HAND2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV672607 1.0 ug DNA
EUR 514

HAND2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV672611 1.0 ug DNA
EUR 514

HAND2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV672612 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HAND2 Rabbit Polyclonal Antibody