PON2 Rabbit Polyclonal Antibody
PON2 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
PON2 Polyclonal Antibody |
ES11145-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PON2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PON2 Polyclonal Antibody |
ABP59969-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PON2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PON2 from Human, Mouse, Rat. This PON2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PON2 protein |
PON2 Polyclonal Antibody |
ABP59969-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PON2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PON2 from Human, Mouse, Rat. This PON2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PON2 protein |
PON2 Polyclonal Antibody |
ABP59969-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PON2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PON2 from Human, Mouse, Rat. This PON2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PON2 protein |
Human Paraoxonase 2 (PON2) ELISA Kit |
DLR-PON2-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Paraoxonase 2 (PON2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Paraoxonase 2 (PON2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Paraoxonase 2 (PON2) ELISA Kit |
DLR-PON2-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Paraoxonase 2 (PON2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Paraoxonase 2 (PON2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Paraoxonase 2 (PON2) ELISA Kit |
DLR-PON2-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Paraoxonase 2 (PON2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Paraoxonase 2 (PON2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Paraoxonase 2 (PON2) ELISA Kit |
DLR-PON2-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Paraoxonase 2 (PON2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Paraoxonase 2 (PON2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Paraoxonase 2 (PON2) ELISA Kit |
RD-PON2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Paraoxonase 2 (PON2) ELISA Kit |
RD-PON2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Paraoxonase 2 (PON2) ELISA Kit |
RD-PON2-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Paraoxonase 2 (PON2) ELISA Kit |
RD-PON2-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Human Paraoxonase 2 (PON2) ELISA Kit |
RDR-PON2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Paraoxonase 2 (PON2) ELISA Kit |
RDR-PON2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Paraoxonase 2 (PON2) ELISA Kit |
RDR-PON2-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Paraoxonase 2 (PON2) ELISA Kit |
RDR-PON2-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
PON2 Rabbit pAb |
A1646-100ul |
Abclonal |
100 ul |
EUR 308 |
PON2 Rabbit pAb |
A1646-200ul |
Abclonal |
200 ul |
EUR 459 |
PON2 Rabbit pAb |
A1646-20ul |
Abclonal |
20 ul |
EUR 183 |
PON2 Rabbit pAb |
A1646-50ul |
Abclonal |
50 ul |
EUR 223 |
PON2 Rabbit pAb |
A14048-100ul |
Abclonal |
100 ul |
EUR 308 |
PON2 Rabbit pAb |
A14048-200ul |
Abclonal |
200 ul |
EUR 459 |
PON2 Rabbit pAb |
A14048-20ul |
Abclonal |
20 ul |
EUR 183 |
PON2 Rabbit pAb |
A14048-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal PON2 Antibody (Center) |
AMR09439G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PON2 (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal PON2 Antibody (N-term) |
AMR09421G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PON2 (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal PON2 Antibody (internal region) |
AMR09440G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PON2 (internal region). This antibody is tested and proven to work in the following applications: |
Paraoxonase 2 (PON2) polyclonal antibody |
ABP-PAB-11651 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
PON2 Antibody |
49891-100ul |
SAB |
100ul |
EUR 333 |
PON2 Antibody |
49891-50ul |
SAB |
50ul |
EUR 239 |
PON2 antibody |
10R-8628 |
Fitzgerald |
100 ul |
EUR 393 |
Description: Mouse monoclonal PON2 antibody |
PON2 Antibody |
32364-100ul |
SAB |
100ul |
EUR 252 |
PON2 antibody |
22565-100ul |
SAB |
100ul |
EUR 390 |
PON2 antibody |
70R-19420 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PON2 antibody |
PON2 antibody |
70R-12772 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal PON2 antibody |
PON2 Antibody |
DF6527 |
Affbiotech |
200ul |
EUR 304 |
Description: PON2 Antibody detects endogenous levels of total PON2. |
PON2 Antibody |
1-CSB-PA613586LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PON2. Recognizes PON2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
PON2 Antibody |
1-CSB-PA018370GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against PON2. Recognizes PON2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
PON2 Antibody |
CSB-PA018370KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against PON2. Recognizes PON2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
PON2 Antibody |
CSB-PA018370KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against PON2. Recognizes PON2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
Paraoxonase 2 (PON2) Polyclonal Antibody (Human) |
4-PAD177Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON2 (Met1~Leu354)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 2 (PON2) |
Paraoxonase 2 (PON2) Polyclonal Antibody (Mouse) |
4-PAD177Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON2 (Met4~Arg289)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Paraoxonase 2 (PON2) |
[KO Validated] PON2 Rabbit pAb |
A19852-100ul |
Abclonal |
100 ul |
EUR 410 |
[KO Validated] PON2 Rabbit pAb |
A19852-200ul |
Abclonal |
200 ul |
EUR 571 |
[KO Validated] PON2 Rabbit pAb |
A19852-20ul |
Abclonal |
20 ul |
EUR 221 |
[KO Validated] PON2 Rabbit pAb |
A19852-50ul |
Abclonal |
50 ul |
EUR 287 |
[KO Validated] PON2 Rabbit pAb |
A19853-100ul |
Abclonal |
100 ul |
EUR 410 |
[KO Validated] PON2 Rabbit pAb |
A19853-200ul |
Abclonal |
200 ul |
EUR 571 |
[KO Validated] PON2 Rabbit pAb |
A19853-20ul |
Abclonal |
20 ul |
EUR 221 |
[KO Validated] PON2 Rabbit pAb |
A19853-50ul |
Abclonal |
50 ul |
EUR 287 |
PON2 Conjugated Antibody |
C49891 |
SAB |
100ul |
EUR 397 |
PON2 Conjugated Antibody |
C32364 |
SAB |
100ul |
EUR 397 |
anti- PON2 antibody |
FNab06639 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:200 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: paraoxonase 2
- Uniprot ID: Q15165
- Gene ID: 5445
- Research Area: Cardiovascular, Metabolism
|
Description: Antibody raised against PON2 |
Anti-PON2 Antibody |
PB9779 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-PON2 Antibody |
PA2254 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-PON2 antibody |
STJ11100728 |
St John's Laboratory |
100 µl |
EUR 413 |
Description: This gene encodes a member of the paraoxonase gene family, which includes three known members located adjacent to each other on the long arm of chromosome 7. The encoded protein is ubiquitously expressed in human tissues, membrane-bound, and may act as a cellular antioxidant, protecting cells from oxidative stress. Hydrolytic activity against acylhomoserine lactones, important bacterial quorum-sensing mediators, suggests the encoded protein may also play a role in defense responses to pathogenic bacteria. Mutations in this gene may be associated with vascular disease and a number of quantitative phenotypes related to diabetes. Alternatively spliced transcript variants encoding different isoforms have been described. |
Anti-PON2 antibody |
STJ11100729 |
St John's Laboratory |
100 µl |
EUR 413 |
Description: This gene encodes a member of the paraoxonase gene family, which includes three known members located adjacent to each other on the long arm of chromosome 7. The encoded protein is ubiquitously expressed in human tissues, membrane-bound, and may act as a cellular antioxidant, protecting cells from oxidative stress. Hydrolytic activity against acylhomoserine lactones, important bacterial quorum-sensing mediators, suggests the encoded protein may also play a role in defense responses to pathogenic bacteria. Mutations in this gene may be associated with vascular disease and a number of quantitative phenotypes related to diabetes. Alternatively spliced transcript variants encoding different isoforms have been described. |
Anti-PON2 antibody |
STJ25057 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the paraoxonase gene family, which includes three known members located adjacent to each other on the long arm of chromosome 7. The encoded protein is ubiquitously expressed in human tissues, membrane-bound, and may act as a cellular antioxidant, protecting cells from oxidative stress. Hydrolytic activity against acylhomoserine lactones, important bacterial quorum-sensing mediators, suggests the encoded protein may also play a role in defense responses to pathogenic bacteria. Mutations in this gene may be associated with vascular disease and a number of quantitative phenotypes related to diabetes. Alternatively spliced transcript variants encoding different isoforms have been described. |
Anti-PON2 antibody |
STJ192303 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PON2 |
Anti-PON2 antibody |
STJ115983 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the paraoxonase gene family, which includes three known members located adjacent to each other on the long arm of chromosome 7. The encoded protein is ubiquitously expressed in human tissues, membrane-bound, and may act as a cellular antioxidant, protecting cells from oxidative stress. Hydrolytic activity against acylhomoserine lactones, important bacterial quorum-sensing mediators, suggests the encoded protein may also play a role in defense responses to pathogenic bacteria. Mutations in this gene may be associated with vascular disease and a number of quantitative phenotypes related to diabetes. Alternatively spliced transcript variants encoding different isoforms have been described. |
Polyclonal Goat Anti-PON2 Antibody (internal region) |
AMM05095G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-PON2 (internal region). This antibody is tested and proven to work in the following applications: |
Paraoxonase 2 (PON2) Polyclonal Antibody (Human), APC |
4-PAD177Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON2 (Met1~Leu354)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 2 (PON2). This antibody is labeled with APC. |
Paraoxonase 2 (PON2) Polyclonal Antibody (Human), Biotinylated |
4-PAD177Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON2 (Met1~Leu354)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 2 (PON2). This antibody is labeled with Biotin. |
Paraoxonase 2 (PON2) Polyclonal Antibody (Human), Cy3 |
4-PAD177Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON2 (Met1~Leu354)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 2 (PON2). This antibody is labeled with Cy3. |
Paraoxonase 2 (PON2) Polyclonal Antibody (Human), FITC |
4-PAD177Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON2 (Met1~Leu354)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 2 (PON2). This antibody is labeled with FITC. |
Paraoxonase 2 (PON2) Polyclonal Antibody (Human), HRP |
4-PAD177Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON2 (Met1~Leu354)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 2 (PON2). This antibody is labeled with HRP. |
Paraoxonase 2 (PON2) Polyclonal Antibody (Human), PE |
4-PAD177Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON2 (Met1~Leu354)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 2 (PON2). This antibody is labeled with PE. |
Paraoxonase 2 (PON2) Polyclonal Antibody (Mouse), APC |
4-PAD177Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON2 (Met4~Arg289)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Paraoxonase 2 (PON2). This antibody is labeled with APC. |
Paraoxonase 2 (PON2) Polyclonal Antibody (Mouse), Biotinylated |
4-PAD177Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON2 (Met4~Arg289)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Paraoxonase 2 (PON2). This antibody is labeled with Biotin. |
Paraoxonase 2 (PON2) Polyclonal Antibody (Mouse), Cy3 |
4-PAD177Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON2 (Met4~Arg289)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Paraoxonase 2 (PON2). This antibody is labeled with Cy3. |
Paraoxonase 2 (PON2) Polyclonal Antibody (Mouse), FITC |
4-PAD177Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON2 (Met4~Arg289)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Paraoxonase 2 (PON2). This antibody is labeled with FITC. |
Paraoxonase 2 (PON2) Polyclonal Antibody (Mouse), HRP |
4-PAD177Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON2 (Met4~Arg289)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Paraoxonase 2 (PON2). This antibody is labeled with HRP. |
Paraoxonase 2 (PON2) Polyclonal Antibody (Mouse), PE |
4-PAD177Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON2 (Met4~Arg289)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Paraoxonase 2 (PON2). This antibody is labeled with PE. |
PON2 siRNA |
20-abx904138 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PON2 siRNA |
20-abx929265 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PON2 siRNA |
20-abx929266 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PON2 |
YF-PA24423 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to PON2 |
Paraoxonase 2 (PON2) Antibody |
20-abx128082 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Paraoxonase 2 (PON2) Antibody |
20-abx129485 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Paraoxonase 2 (PON2) Antibody |
20-abx173951 |
Abbexa |
|
|
|
Paraoxonase 2 (PON2) Antibody |
20-abx177913 |
Abbexa |
|
|
|
PON2 Antibody, HRP conjugated |
1-CSB-PA613586LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PON2. Recognizes PON2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PON2 Antibody, FITC conjugated |
1-CSB-PA613586LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PON2. Recognizes PON2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PON2 Antibody, Biotin conjugated |
1-CSB-PA613586LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PON2. Recognizes PON2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Paraoxonase 2 (PON2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAD177Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON2 (Met1~Leu354)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 2 (PON2). This antibody is labeled with APC-Cy7. |
Paraoxonase 2 (PON2) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAD177Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON2 (Met4~Arg289)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Paraoxonase 2 (PON2). This antibody is labeled with APC-Cy7. |
PON2 cloning plasmid |
CSB-CL613586HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 660
- Sequence: atggggcggctggtggctgtgggcttgctggggatcgcgctggcgctcctgggcgagaggcttctggcactcagaaatcgacttaaagcctccagagaagtagaatctgtagaccttccacactgccacctgattaaaggaattgaagctggctctgaagatattgacatacttcc
- Show more
|
Description: A cloning plasmid for the PON2 gene. |
PON2 Blocking Peptide |
DF6527-BP |
Affbiotech |
1mg |
EUR 195 |
anti-PON2 (AF3E6) |
LF-MA0349 |
Abfrontier |
100 ul |
EUR 334 |
Description: Mouse monoclonal to PON2 |
Rabbit Serum paraoxonase/arylesterase 2(PON2) ELISA kit |
E04S0342-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Serum paraoxonase/arylesterase 2(PON2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Serum paraoxonase/arylesterase 2(PON2) ELISA kit |
E04S0342-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Serum paraoxonase/arylesterase 2(PON2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Serum paraoxonase/arylesterase 2(PON2) ELISA kit |
E04S0342-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Serum paraoxonase/arylesterase 2(PON2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Serum Paraoxonase/arylesterase 2 (PON2) Antibody |
abx117133-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
Serum Paraoxonase/arylesterase 2 (PON2) Antibody |
20-abx001386 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Serum Paraoxonase/arylesterase 2 (PON2) Antibody |
20-abx142155 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Serum Paraoxonase/arylesterase 2 (PON2) Antibody |
abx036896-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Serum Paraoxonase/arylesterase 2 (PON2) Antibody |
abx032607-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serum Paraoxonase/arylesterase 2 (PON2) Antibody |
abx032607-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serum Paraoxonase/arylesterase 2 (PON2) Antibody |
abx027111-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serum Paraoxonase/arylesterase 2 (PON2) Antibody |
abx027111-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serum Paraoxonase/arylesterase 2 (PON2) Antibody |
abx431888-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Serum Paraoxonase/arylesterase 2 (PON2) Antibody |
abx431928-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Serum Paraoxonase/arylesterase 2 (PON2) Antibody |
abx236639-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Serum Paraoxonase/arylesterase 2 (PON2) Antibody |
20-abx301069 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Active Paraoxonase 2 (PON2) |
4-APD177Hu01 |
Cloud-Clone |
-
EUR 777.38
-
EUR 311.00
-
EUR 2640.16
-
EUR 946.72
-
EUR 1793.44
-
EUR 583.00
-
EUR 6450.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q15165
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): Inquire
- Isoelectric Point: 5.3
|
Description: Recombinant Human Active Paraoxonase 2 (PON2) expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells |
Rat PON2 shRNA Plasmid |
20-abx988831 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PON2 shRNA Plasmid |
20-abx983602 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PON2 shRNA Plasmid |
20-abx953648 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Recombinant Paraoxonase 2 (PoN2) |
4-RPD177Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q15165
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 43.1kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Paraoxonase 2 expressed in: E.coli |
Recombinant Paraoxonase 2 (PON2) |
4-RPD177Mu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q62086
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 35.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Paraoxonase 2 expressed in: E.coli |
PON2 Recombinant Protein (Human) |
RP024148 |
ABM |
100 ug |
Ask for price |
PON2 Recombinant Protein (Rat) |
RP221432 |
ABM |
100 ug |
Ask for price |
PON2 Recombinant Protein (Mouse) |
RP163472 |
ABM |
100 ug |
Ask for price |
Serum Paraoxonase/arylesterase 2 (PON2) Antibody (HRP) |
20-abx316191 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serum Paraoxonase/arylesterase 2 (PON2) Antibody (FITC) |
20-abx316192 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serum Paraoxonase/arylesterase 2 (PON2) Antibody (Biotin) |
20-abx316193 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mouse Paraoxonase 2 (PON2) Protein |
20-abx167355 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Paraoxonase 2 (PoN2) Protein |
20-abx166714 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
PON2 ORF Vector (Human) (pORF) |
ORF008050 |
ABM |
1.0 ug DNA |
EUR 95 |
Pon2 ORF Vector (Rat) (pORF) |
ORF073812 |
ABM |
1.0 ug DNA |
EUR 506 |
Pon2 ORF Vector (Mouse) (pORF) |
ORF054492 |
ABM |
1.0 ug DNA |
EUR 95 |
PON2 ELISA Kit (Human) (OKAN06250) |
OKAN06250 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a member of the paraoxonase gene family, which includes three known members located adjacent to each other on the long arm of chromosome 7. The encoded protein is ubiquitously expressed in human tissues, membrane-bound, and may act as a cellular antioxidant, protecting cells from oxidative stress. Hydrolytic activity against acylhomoserine lactones, important bacterial quorum-sensing mediators, suggests the encoded protein may also play a role in defense responses to pathogenic bacteria. Mutations in this gene may be associated with vascular disease and a number of quantitative phenotypes related to diabetes. Alternatively spliced transcript variants encoding different isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.27 ng/mL |
PON2 ELISA Kit (Mouse) (OKCD02815) |
OKCD02815 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: Capable of hydrolyzing lactones and a number of aromatic carboxylic acid esters. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.052 ng/mL |
PON2 ELISA Kit (Human) (OKCD08406) |
OKCD08406 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: Recombinant Human Paraoxonase-2;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.32ng/mL |
PON2 ELISA Kit (Rat) (OKEH03580) |
OKEH03580 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Capable of hydrolyzing lactones and a number of aromatic carboxylic acid esters.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL |
PON2 ELISA Kit (Mouse) (OKEH07118) |
OKEH07118 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Capable of hydrolyzing lactones and a number of aromatic carboxylic acid esters.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.081 ng/mL |
PON2 ELISA Kit (Bovine) (OKEH07519) |
OKEH07519 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
PON2 ELISA Kit (Chicken) (OKEH07520) |
OKEH07520 |
Aviva Systems Biology |
96 Wells |
EUR 1184 |
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
PON2 ELISA Kit (Dog) (OKEH07521) |
OKEH07521 |
Aviva Systems Biology |
96 Wells |
EUR 1184 |
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
Human Paraoxonase 2 (PON2) Protein (Active) |
20-abx655794 |
Abbexa |
-
EUR 1066.00
-
EUR 398.00
-
EUR 3530.00
-
EUR 1288.00
-
EUR 732.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Paraoxonase 2 (PON2) ELISA Kit |
20-abx154505 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Paraoxonase 2 (PON2) ELISA Kit |
20-abx152643 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Paraoxonase 2 (PON2) CLIA Kit |
20-abx494121 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Paraoxonase 2 (PON2) CLIA Kit |
20-abx494122 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Paraoxonase 2 (PON2) ELISA Kit |
abx250364-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
PON2 sgRNA CRISPR Lentivector set (Human) |
K1687901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pon2 sgRNA CRISPR Lentivector set (Mouse) |
K4170601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pon2 sgRNA CRISPR Lentivector set (Rat) |
K6745701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Paraoxonase 2 ELISA Kit (PON2) |
RK02115 |
Abclonal |
96 Tests |
EUR 521 |
PON2 Paraoxonase-2 Human Recombinant Protein |
PROTQ15165 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: Paraoxonase-2 Human Recombinant is expressed in E. Coli having a molecular weight of 43.5 kDa and fused to an amino terminal hexahistidine tag.;The PON2 purified by proprietary chromatographic techniques. |
Human Paraoxonase 2 (PON2) ELISA Kit |
SED177Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 2 (PON2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 2 (PON2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Paraoxonase 2 (PON2) ELISA Kit |
SED177Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 2 (PON2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 2 (PON2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Paraoxonase 2 (PON2) ELISA Kit |
SED177Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 2 (PON2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 2 (PON2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Paraoxonase 2 (PON2) ELISA Kit |
SED177Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 2 (PON2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 2 (PON2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Paraoxonase 2 (PON2) ELISA Kit |
4-SED177Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Paraoxonase 2 elisa. Alternative names of the recognized antigen: Serum Paraoxonase/Arylesterase 2
- Paraoxonase Nirs
- Aromatic esterase 2
- Serum aryldialkylphosphatase 2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Paraoxonase 2 (PON2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Paraoxonase 2 (PON2) ELISA Kit |
SED177Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Paraoxonase 2 (PON2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Paraoxonase 2 (PON2) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Paraoxonase 2 (PON2) ELISA Kit |
SED177Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Paraoxonase 2 (PON2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Paraoxonase 2 (PON2) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Paraoxonase 2 (PON2) ELISA Kit |
SED177Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Paraoxonase 2 (PON2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Paraoxonase 2 (PON2) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Paraoxonase 2 (PON2) ELISA Kit |
SED177Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Paraoxonase 2 (PON2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Paraoxonase 2 (PON2) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Paraoxonase 2 (PON2) ELISA Kit |
4-SED177Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Paraoxonase 2 elisa. Alternative names of the recognized antigen: Serum Paraoxonase/Arylesterase 2
- Paraoxonase Nirs
- Aromatic esterase 2
- Serum aryldialkylphosphatase 2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Paraoxonase 2 (PON2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
PON2 Rabbit Polyclonal Antibody