PLOD2 Rabbit Polyclonal Antibody
PLOD2 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
PLOD2 Polyclonal Antibody |
ABP59944-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PLOD2 protein at amino acid sequence of 600-680
- Applications tips:
|
Description: A polyclonal antibody for detection of PLOD2 from Human, Mouse, Rat. This PLOD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLOD2 protein at amino acid sequence of 600-680 |
PLOD2 Polyclonal Antibody |
ABP59944-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PLOD2 protein at amino acid sequence of 600-680
- Applications tips:
|
Description: A polyclonal antibody for detection of PLOD2 from Human, Mouse, Rat. This PLOD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLOD2 protein at amino acid sequence of 600-680 |
PLOD2 Polyclonal Antibody |
ABP59944-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PLOD2 protein at amino acid sequence of 600-680
- Applications tips:
|
Description: A polyclonal antibody for detection of PLOD2 from Human, Mouse, Rat. This PLOD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLOD2 protein at amino acid sequence of 600-680 |
PLOD2 Polyclonal Antibody |
A63150 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
PLOD2 Polyclonal Antibody |
30767-100ul |
SAB |
100ul |
EUR 252 |
PLOD2 Polyclonal Antibody |
30767-50ul |
SAB |
50ul |
EUR 187 |
PLOD2 Polyclonal Antibody |
28422-100ul |
SAB |
100ul |
EUR 252 |
PLOD2 Polyclonal Antibody |
28422-50ul |
SAB |
50ul |
EUR 187 |
PLOD2 Rabbit pAb |
A14045-100ul |
Abclonal |
100 ul |
EUR 308 |
PLOD2 Rabbit pAb |
A14045-200ul |
Abclonal |
200 ul |
EUR 459 |
PLOD2 Rabbit pAb |
A14045-20ul |
Abclonal |
20 ul |
EUR 183 |
PLOD2 Rabbit pAb |
A14045-50ul |
Abclonal |
50 ul |
EUR 223 |
PLOD2 Rabbit pAb |
A6946-100ul |
Abclonal |
100 ul |
EUR 308 |
PLOD2 Rabbit pAb |
A6946-200ul |
Abclonal |
200 ul |
EUR 459 |
PLOD2 Rabbit pAb |
A6946-20ul |
Abclonal |
20 ul |
EUR 183 |
PLOD2 Rabbit pAb |
A6946-50ul |
Abclonal |
50 ul |
EUR 223 |
PLOD2 Polyclonal Conjugated Antibody |
C30767 |
SAB |
100ul |
EUR 397 |
PLOD2 Polyclonal Conjugated Antibody |
C28422 |
SAB |
100ul |
EUR 397 |
PLOD2 antibody |
70R-5438 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PLOD2 antibody raised against the middle region of PLOD2 |
PLOD2 antibody |
70R-36602 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Rabbit Polyclonal PLOD2 antibody |
PLOD2 antibody |
70R-19352 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PLOD2 antibody |
PLOD2 Antibody |
1-CSB-PA018200GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against PLOD2. Recognizes PLOD2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
PLOD2 Antibody |
1-CSB-PA018200LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLOD2. Recognizes PLOD2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
Polyclonal PLOD2 Antibody (C-term) |
APR10906G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLOD2 (C-term). This antibody is tested and proven to work in the following applications: |
PLOD2 Polyclonal Antibody, HRP Conjugated |
A63151 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
PLOD2 Polyclonal Antibody, FITC Conjugated |
A63152 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
PLOD2 Polyclonal Antibody, Biotin Conjugated |
A63153 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit |
DLR-PLOD2-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit |
DLR-PLOD2-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit |
RD-PLOD2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit |
RD-PLOD2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit |
RDR-PLOD2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit |
RDR-PLOD2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
PLOD2-Specific Antibody |
abx236552-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
PLOD2-Specific Antibody |
DF12018 |
Affbiotech |
200ul |
EUR 304 |
Description: PLOD2-Specific antibody detects endogenous levels of PLOD2-Specific. |
Anti-PLOD2 antibody |
STJ29026 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. Mutations in the coding region of this gene are associated with Bruck syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. |
Anti-PLOD2 antibody |
STJ192482 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PLOD2 |
Anti-PLOD2 antibody |
STJ115980 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. Mutations in the coding region of this gene are associated with Bruck syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. |
PLOD2 siRNA |
20-abx928976 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PLOD2 siRNA |
20-abx928977 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PLOD2 |
YF-PA13829 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to PLOD2 |
anti-PLOD2 |
YF-PA13830 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to PLOD2 |
anti-PLOD2 |
YF-PA13831 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to PLOD2 |
anti- PLOD2-Specific antibody |
FNab06552 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:1000
- IP: 1:200-1:1000
- IHC: 1:100-1:400
- IF: 1:10-1:100
- Immunogen: procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2
- Uniprot ID: O00469
- Research Area: Metabolism
|
Description: Antibody raised against PLOD2-Specific |
PLOD2 Antibody, HRP conjugated |
1-CSB-PA018200LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLOD2. Recognizes PLOD2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PLOD2 Antibody, FITC conjugated |
1-CSB-PA018200LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLOD2. Recognizes PLOD2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PLOD2 Antibody, Biotin conjugated |
1-CSB-PA018200LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLOD2. Recognizes PLOD2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
PLOD2 cloning plasmid |
CSB-CL018200HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2277
- Sequence: atggggggatgcacggtgaagcctcagctgctgctcctggcgctcgtcctccacccctggaatccctgtctgggtgcggactcggagaagccctcgagcatccccacagataaattattagtcataactgtagcaacaaaagaaagtgatggattccatcgatttatgcagtcag
- Show more
|
Description: A cloning plasmid for the PLOD2 gene. |
PLOD2 Blocking Peptide |
33R-4019 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PLOD2 antibody, catalog no. 70R-5438 |
Mouse PLOD2 shRNA Plasmid |
20-abx973717 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PLOD2 shRNA Plasmid |
20-abx953591 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PLOD2-Specific Blocking Peptide |
DF12018-BP |
Affbiotech |
1mg |
EUR 195 |
PLOD2 Recombinant Protein (Human) |
RP023824 |
ABM |
100 ug |
Ask for price |
PLOD2 Recombinant Protein (Rat) |
RP221033 |
ABM |
100 ug |
Ask for price |
PLOD2 Recombinant Protein (Rat) |
RP221036 |
ABM |
100 ug |
Ask for price |
PLOD2 Recombinant Protein (Mouse) |
RP162947 |
ABM |
100 ug |
Ask for price |
PLOD2 Recombinant Protein (Mouse) |
RP162950 |
ABM |
100 ug |
Ask for price |
Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) Polyclonal Antibody (Human) |
4-PAE257Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLOD2 (Lys644~Pro737)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) |
PLOD2 ORF Vector (Human) (pORF) |
ORF007942 |
ABM |
1.0 ug DNA |
EUR 95 |
Plod2 ORF Vector (Rat) (pORF) |
ORF073679 |
ABM |
1.0 ug DNA |
EUR 506 |
Plod2 ORF Vector (Rat) (pORF) |
ORF073680 |
ABM |
1.0 ug DNA |
EUR 506 |
Plod2 ORF Vector (Mouse) (pORF) |
ORF054317 |
ABM |
1.0 ug DNA |
EUR 506 |
Plod2 ORF Vector (Mouse) (pORF) |
ORF054318 |
ABM |
1.0 ug DNA |
EUR 506 |
PLOD2 ELISA Kit (Human) (OKCD00421) |
OKCD00421 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Forms hydroxylysine residues in -Xaa-Lys-Gly- sequences in collagens. These hydroxylysines serve as sites of attachment for carbohydrate units and are essential for the stability of the intermolecular collagen cross-links. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.057 ng/mL |
Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) Polyclonal Antibody (Human), APC |
4-PAE257Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLOD2 (Lys644~Pro737)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2). This antibody is labeled with APC. |
Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) Polyclonal Antibody (Human), Biotinylated |
4-PAE257Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLOD2 (Lys644~Pro737)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2). This antibody is labeled with Biotin. |
Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) Polyclonal Antibody (Human), Cy3 |
4-PAE257Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLOD2 (Lys644~Pro737)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2). This antibody is labeled with Cy3. |
Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) Polyclonal Antibody (Human), FITC |
4-PAE257Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLOD2 (Lys644~Pro737)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2). This antibody is labeled with FITC. |
Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) Polyclonal Antibody (Human), HRP |
4-PAE257Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLOD2 (Lys644~Pro737)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2). This antibody is labeled with HRP. |
Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) Polyclonal Antibody (Human), PE |
4-PAE257Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLOD2 (Lys644~Pro737)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2). This antibody is labeled with PE. |
PLOD2 sgRNA CRISPR Lentivector set (Human) |
K1669901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Plod2 sgRNA CRISPR Lentivector set (Mouse) |
K3529301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Plod2 sgRNA CRISPR Lentivector set (Rat) |
K6660601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAE257Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLOD2 (Lys644~Pro737)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2). This antibody is labeled with APC-Cy7. |
Procollagen-Lysine, 2-Oxoglutarate 5-Dioxygenase 2 (PLOD2) Antibody |
20-abx114686 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) Antibody |
20-abx128434 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) Antibody |
abx034642-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) Antibody |
abx034642-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) Antibody |
abx036829-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) Antibody |
20-abx005269 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) Antibody |
20-abx174163 |
Abbexa |
|
|
|
Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) Antibody |
20-abx304850 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
PLOD2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1669902 |
ABM |
1.0 ug DNA |
EUR 154 |
PLOD2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1669903 |
ABM |
1.0 ug DNA |
EUR 154 |
PLOD2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1669904 |
ABM |
1.0 ug DNA |
EUR 154 |
Plod2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3529302 |
ABM |
1.0 ug DNA |
EUR 154 |
Plod2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3529303 |
ABM |
1.0 ug DNA |
EUR 154 |
Plod2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3529304 |
ABM |
1.0 ug DNA |
EUR 154 |
Plod2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6660602 |
ABM |
1.0 ug DNA |
EUR 154 |
Plod2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6660603 |
ABM |
1.0 ug DNA |
EUR 154 |
Plod2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6660604 |
ABM |
1.0 ug DNA |
EUR 154 |
PLOD2 Protein Vector (Human) (pPB-C-His) |
PV031765 |
ABM |
500 ng |
EUR 329 |
PLOD2 Protein Vector (Human) (pPB-N-His) |
PV031766 |
ABM |
500 ng |
EUR 329 |
PLOD2 Protein Vector (Human) (pPM-C-HA) |
PV031767 |
ABM |
500 ng |
EUR 329 |
PLOD2 Protein Vector (Human) (pPM-C-His) |
PV031768 |
ABM |
500 ng |
EUR 329 |
PLOD2 Protein Vector (Mouse) (pPB-C-His) |
PV217266 |
ABM |
500 ng |
EUR 1065 |
PLOD2 Protein Vector (Mouse) (pPB-N-His) |
PV217267 |
ABM |
500 ng |
EUR 1065 |
PLOD2 Protein Vector (Mouse) (pPM-C-HA) |
PV217268 |
ABM |
500 ng |
EUR 1065 |
PLOD2 Protein Vector (Mouse) (pPM-C-His) |
PV217269 |
ABM |
500 ng |
EUR 1065 |
PLOD2 Protein Vector (Mouse) (pPB-C-His) |
PV217270 |
ABM |
500 ng |
EUR 1065 |
PLOD2 Protein Vector (Mouse) (pPB-N-His) |
PV217271 |
ABM |
500 ng |
EUR 1065 |
PLOD2 Protein Vector (Mouse) (pPM-C-HA) |
PV217272 |
ABM |
500 ng |
EUR 1065 |
PLOD2 Protein Vector (Mouse) (pPM-C-His) |
PV217273 |
ABM |
500 ng |
EUR 1065 |
PLOD2 Protein Vector (Rat) (pPB-C-His) |
PV294714 |
ABM |
500 ng |
EUR 1166 |
PLOD2 Protein Vector (Rat) (pPB-N-His) |
PV294715 |
ABM |
500 ng |
EUR 1166 |
PLOD2 Protein Vector (Rat) (pPM-C-HA) |
PV294716 |
ABM |
500 ng |
EUR 1166 |
PLOD2 Protein Vector (Rat) (pPM-C-His) |
PV294717 |
ABM |
500 ng |
EUR 1166 |
PLOD2 Protein Vector (Rat) (pPB-C-His) |
PV294718 |
ABM |
500 ng |
EUR 1166 |
PLOD2 Protein Vector (Rat) (pPB-N-His) |
PV294719 |
ABM |
500 ng |
EUR 1166 |
PLOD2 Protein Vector (Rat) (pPM-C-HA) |
PV294720 |
ABM |
500 ng |
EUR 1166 |
PLOD2 Protein Vector (Rat) (pPM-C-His) |
PV294721 |
ABM |
500 ng |
EUR 1166 |
Plod2 3'UTR GFP Stable Cell Line |
TU166567 |
ABM |
1.0 ml |
Ask for price |
PLOD2 3'UTR Luciferase Stable Cell Line |
TU018285 |
ABM |
1.0 ml |
EUR 1394 |
Plod2 3'UTR Luciferase Stable Cell Line |
TU116567 |
ABM |
1.0 ml |
Ask for price |
PLOD2 3'UTR GFP Stable Cell Line |
TU068285 |
ABM |
1.0 ml |
EUR 1394 |
Plod2 3'UTR GFP Stable Cell Line |
TU266424 |
ABM |
1.0 ml |
Ask for price |
Plod2 3'UTR Luciferase Stable Cell Line |
TU216424 |
ABM |
1.0 ml |
Ask for price |
Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) Antibody (HRP) |
20-abx304851 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) Antibody (FITC) |
20-abx304852 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) Antibody (Biotin) |
20-abx304853 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
PLOD2 Rabbit Polyclonal Antibody