DPPA4 Rabbit Polyclonal Antibody
DPPA4 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
DPPA4 Polyclonal Antibody |
ABP58414-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human DPPA4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of DPPA4 from Human, Mouse, Rat. This DPPA4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DPPA4 protein |
DPPA4 Polyclonal Antibody |
ABP58414-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human DPPA4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of DPPA4 from Human, Mouse, Rat. This DPPA4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DPPA4 protein |
DPPA4 Polyclonal Antibody |
ABP58414-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human DPPA4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of DPPA4 from Human, Mouse, Rat. This DPPA4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DPPA4 protein |
DPPA4 Polyclonal Antibody |
A58842 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
DPPA4 Polyclonal Antibody |
ES11028-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against DPPA4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DPPA4 Polyclonal Antibody |
ES11028-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against DPPA4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DPPA4 Rabbit pAb |
A13724-100ul |
Abclonal |
100 ul |
EUR 308 |
DPPA4 Rabbit pAb |
A13724-200ul |
Abclonal |
200 ul |
EUR 459 |
DPPA4 Rabbit pAb |
A13724-20ul |
Abclonal |
20 ul |
EUR 183 |
DPPA4 Rabbit pAb |
A13724-50ul |
Abclonal |
50 ul |
EUR 223 |
DPPA4 Rabbit pAb |
A13725-100ul |
Abclonal |
100 ul |
EUR 308 |
DPPA4 Rabbit pAb |
A13725-200ul |
Abclonal |
200 ul |
EUR 459 |
DPPA4 Rabbit pAb |
A13725-20ul |
Abclonal |
20 ul |
EUR 183 |
DPPA4 Rabbit pAb |
A13725-50ul |
Abclonal |
50 ul |
EUR 223 |
DPPA4 Rabbit pAb |
A9238-100ul |
Abclonal |
100 ul |
EUR 308 |
DPPA4 Rabbit pAb |
A9238-200ul |
Abclonal |
200 ul |
EUR 459 |
DPPA4 Rabbit pAb |
A9238-20ul |
Abclonal |
20 ul |
Ask for price |
DPPA4 Rabbit pAb |
A9238-50ul |
Abclonal |
50 ul |
Ask for price |
Polyclonal DPPA4 Antibody (Center) |
APC00108G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DPPA4 (Center). This antibody is tested and proven to work in the following applications: |
DPPA4 antibody |
70R-12122 |
Fitzgerald |
100 ug |
EUR 403 |
Description: Rabbit polyclonal DPPA4 antibody |
DPPA4 Antibody |
47509-100ul |
SAB |
100ul |
EUR 252 |
DPPA4 Antibody |
1-CSB-PA765975EA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DPPA4. Recognizes DPPA4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
DPPA4 antibody |
70R-3293 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal DPPA4 antibody raised against the N terminal of DPPA4 |
Polyclonal DPPA4 Antibody (aa1-50) |
APR02983G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DPPA4 (aa1-50). This antibody is tested and proven to work in the following applications: |
Polyclonal DPPA4 Antibody (N-term) |
AMM06955G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DPPA4 (N-term). This antibody is tested and proven to work in the following applications: |
DPPA4 Polyclonal Antibody, Biotin Conjugated |
A58843 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
DPPA4 Polyclonal Antibody, FITC Conjugated |
A58844 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
DPPA4 Polyclonal Antibody, HRP Conjugated |
A58845 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Anti-DPPA4 Antibody |
A10283 |
BosterBio |
100 ug |
EUR 397 |
Description: Rabbit Polyclonal DPPA4 Antibody. Validated in WB and tested in Human. |
DPPA4 Conjugated Antibody |
C47509 |
SAB |
100ul |
EUR 397 |
anti- DPPA4 antibody |
FNab02525 |
FN Test |
100µg |
EUR 585 |
- Immunogen: developmental pluripotency associated 4
- Uniprot ID: Q7L190
- Gene ID: 55211
- Research Area: Stem Cells
|
Description: Antibody raised against DPPA4 |
Anti-DPPA4 antibody |
STJ111623 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a nuclear factor that is involved in the maintenance of pluripotency in stem cells and essential for embryogenesis. The encoded protein has a scaffold-attachment factor A/B, acinus and PIAS (SAP) domain that binds DNA and is thought to modify chromatin. Mice with a homozygous knockout of the orthologous gene die during late embryonic development or within hours after birth. Knockout embryos are normal in size at embryonic day 18.5 but exhibit skeletal and lung tissue abnormalities. This gene, when mutated, is highly expressed in embryonal carcinomas, pluripotent germ cell tumors, and other cancers and is thought to play an important role in tumor progression. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. |
Anti-DPPA4 antibody |
STJ115677 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a nuclear factor that is involved in the maintenance of pluripotency in stem cells and essential for embryogenesis. The encoded protein has a scaffold-attachment factor A/B, acinus and PIAS (SAP) domain that binds DNA and is thought to modify chromatin. Mice with a homozygous knockout of the orthologous gene die during late embryonic development or within hours after birth. Knockout embryos are normal in size at embryonic day 18.5 but exhibit skeletal and lung tissue abnormalities. This gene, when mutated, is highly expressed in embryonal carcinomas, pluripotent germ cell tumors, and other cancers and is thought to play an important role in tumor progression. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. |
Anti-DPPA4 antibody |
STJ115678 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a nuclear factor that is involved in the maintenance of pluripotency in stem cells and essential for embryogenesis. The encoded protein has a scaffold-attachment factor A/B, acinus and PIAS (SAP) domain that binds DNA and is thought to modify chromatin. Mice with a homozygous knockout of the orthologous gene die during late embryonic development or within hours after birth. Knockout embryos are normal in size at embryonic day 18.5 but exhibit skeletal and lung tissue abnormalities. This gene, when mutated, is highly expressed in embryonal carcinomas, pluripotent germ cell tumors, and other cancers and is thought to play an important role in tumor progression. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. |
Anti-DPPA4 antibody |
STJ192186 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to DPPA4 |
DPPA4 siRNA |
20-abx914576 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DPPA4 siRNA |
20-abx914577 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-Dppa4 |
YF-PA19622 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to Dppa4 |
anti-Dppa4 |
YF-PA19623 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Dppa4 |
anti-Dppa4 |
YF-PA19624 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Dppa4 |
anti-Dppa4 |
YF-PA19625 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to Dppa4 |
DPPA4 Antibody, HRP conjugated |
1-CSB-PA765975EB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DPPA4. Recognizes DPPA4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
DPPA4 Antibody, FITC conjugated |
1-CSB-PA765975EC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DPPA4. Recognizes DPPA4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
DPPA4 Antibody, Biotin conjugated |
1-CSB-PA765975ED01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DPPA4. Recognizes DPPA4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
DPPA4 Blocking Peptide |
33R-10939 |
Fitzgerald |
50 ug |
EUR 191 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DPPA4 antibody, catalog no. 70R-12122 |
DPPA4 Blocking Peptide |
33R-6210 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DPPA4 antibody, catalog no. 70R-3293 |
DPPA4 Blocking Peptide |
3826BP-50 |
Biovision |
|
EUR 153 |
DPPA4 cloning plasmid |
CSB-CL765975HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 885
- Sequence: atggagaaggcaaaaggcaaggagtggacctccacagagaagtcgagggaagaggatcagcaggcttctaatcaaccaaattcaattgctttgccaggaacatcagcaaagagaaccaaagaaaaaatgtctgtcaaaggcagtaaagtgctctgccctaagaaaaaggcagagca
- Show more
|
Description: A cloning plasmid for the DPPA4 gene. |
DPPA4 protein (His tag) |
80R-2904 |
Fitzgerald |
100 ug |
EUR 424 |
Description: Purified recombinant DPPA4 protein (His tag) |
Mouse DPPA4 shRNA Plasmid |
20-abx978001 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human DPPA4 shRNA Plasmid |
20-abx960560 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DPPA4 Recombinant Protein (Human) |
RP009781 |
ABM |
100 ug |
Ask for price |
DPPA4 Recombinant Protein (Mouse) |
RP129977 |
ABM |
100 ug |
Ask for price |
DPPA4 Recombinant Protein (Mouse) |
RP129980 |
ABM |
100 ug |
Ask for price |
Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody |
abx028023-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody |
abx028023-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody |
20-abx124682 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody |
20-abx301459 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody |
abx232525-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
DPPA4 ORF Vector (Human) (pORF) |
ORF003261 |
ABM |
1.0 ug DNA |
EUR 95 |
Dppa4 ORF Vector (Mouse) (pORF) |
ORF043327 |
ABM |
1.0 ug DNA |
EUR 506 |
Dppa4 ORF Vector (Mouse) (pORF) |
ORF043328 |
ABM |
1.0 ug DNA |
EUR 506 |
Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody (HRP) |
20-abx308169 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody (FITC) |
20-abx308170 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody (Biotin) |
20-abx308171 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
DPPA4 sgRNA CRISPR Lentivector set (Human) |
K0628801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Dppa4 sgRNA CRISPR Lentivector set (Mouse) |
K4938401 |
ABM |
3 x 1.0 ug |
EUR 339 |
DPPA4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0628802 |
ABM |
1.0 ug DNA |
EUR 154 |
DPPA4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0628803 |
ABM |
1.0 ug DNA |
EUR 154 |
DPPA4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0628804 |
ABM |
1.0 ug DNA |
EUR 154 |
Dppa4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4938402 |
ABM |
1.0 ug DNA |
EUR 154 |
Dppa4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4938403 |
ABM |
1.0 ug DNA |
EUR 154 |
Dppa4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4938404 |
ABM |
1.0 ug DNA |
EUR 154 |
DPPA4 Protein Vector (Mouse) (pPB-C-His) |
PV173306 |
ABM |
500 ng |
EUR 603 |
DPPA4 Protein Vector (Mouse) (pPB-N-His) |
PV173307 |
ABM |
500 ng |
EUR 603 |
DPPA4 Protein Vector (Mouse) (pPM-C-HA) |
PV173308 |
ABM |
500 ng |
EUR 603 |
DPPA4 Protein Vector (Mouse) (pPM-C-His) |
PV173309 |
ABM |
500 ng |
EUR 603 |
DPPA4 Protein Vector (Mouse) (pPB-C-His) |
PV173310 |
ABM |
500 ng |
EUR 603 |
DPPA4 Protein Vector (Mouse) (pPB-N-His) |
PV173311 |
ABM |
500 ng |
EUR 603 |
DPPA4 Protein Vector (Mouse) (pPM-C-HA) |
PV173312 |
ABM |
500 ng |
EUR 603 |
DPPA4 Protein Vector (Mouse) (pPM-C-His) |
PV173313 |
ABM |
500 ng |
EUR 603 |
DPPA4 Protein Vector (Human) (pPB-C-His) |
PV013041 |
ABM |
500 ng |
EUR 329 |
DPPA4 Protein Vector (Human) (pPB-N-His) |
PV013042 |
ABM |
500 ng |
EUR 329 |
DPPA4 Protein Vector (Human) (pPM-C-HA) |
PV013043 |
ABM |
500 ng |
EUR 329 |
DPPA4 Protein Vector (Human) (pPM-C-His) |
PV013044 |
ABM |
500 ng |
EUR 329 |
Recombinant Human DPPA4 Protein, His, E.coli-1mg |
QP11699-1mg |
EnQuireBio |
1mg |
EUR 3655 |
Recombinant Human DPPA4 Protein, His, E.coli-20ug |
QP11699-20ug |
EnQuireBio |
20ug |
EUR 201 |
Recombinant Human DPPA4 Protein, His, E.coli-5ug |
QP11699-5ug |
EnQuireBio |
5ug |
EUR 155 |
Dppa4 3'UTR GFP Stable Cell Line |
TU155370 |
ABM |
1.0 ml |
Ask for price |
Dppa4 3'UTR Luciferase Stable Cell Line |
TU105370 |
ABM |
1.0 ml |
Ask for price |
DPPA4 3'UTR GFP Stable Cell Line |
TU056286 |
ABM |
1.0 ml |
EUR 1521 |
DPPA4 3'UTR Luciferase Stable Cell Line |
TU006286 |
ABM |
1.0 ml |
EUR 1521 |
DPPA4 Developmental Pluripotency Associated 4 Human Recombinant Protein |
PROTQ7L190 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: DPPA4 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 327 amino acids (1-304) and having a molecular mass of 35.9kDa.;DPPA4 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
DPPA4 Rabbit Polyclonal Antibody