DPPA4 Rabbit Polyclonal Antibody

DPPA4 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

DPPA4 Polyclonal Antibody
ABP58414-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human DPPA4 protein Applications tips:
Description: A polyclonal antibody for detection of DPPA4 from Human, Mouse, Rat. This DPPA4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DPPA4 protein

DPPA4 Polyclonal Antibody
ABP58414-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human DPPA4 protein Applications tips:
Description: A polyclonal antibody for detection of DPPA4 from Human, Mouse, Rat. This DPPA4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DPPA4 protein

DPPA4 Polyclonal Antibody
ABP58414-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human DPPA4 protein Applications tips:
Description: A polyclonal antibody for detection of DPPA4 from Human, Mouse, Rat. This DPPA4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DPPA4 protein

DPPA4 Polyclonal Antibody
A58842	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

DPPA4 Polyclonal Antibody
ES11028-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against DPPA4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

DPPA4 Polyclonal Antibody
ES11028-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against DPPA4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

DPPA4 Rabbit pAb
A13724-100ul	Abclonal	100 ul	EUR 308

DPPA4 Rabbit pAb
A13724-200ul	Abclonal	200 ul	EUR 459

DPPA4 Rabbit pAb
A13724-20ul	Abclonal	20 ul	EUR 183

DPPA4 Rabbit pAb
A13724-50ul	Abclonal	50 ul	EUR 223

DPPA4 Rabbit pAb
A13725-100ul	Abclonal	100 ul	EUR 308

DPPA4 Rabbit pAb
A13725-200ul	Abclonal	200 ul	EUR 459

DPPA4 Rabbit pAb
A13725-20ul	Abclonal	20 ul	EUR 183

DPPA4 Rabbit pAb
A13725-50ul	Abclonal	50 ul	EUR 223

DPPA4 Rabbit pAb
A9238-100ul	Abclonal	100 ul	EUR 308

DPPA4 Rabbit pAb
A9238-200ul	Abclonal	200 ul	EUR 459

DPPA4 Rabbit pAb
A9238-20ul	Abclonal	20 ul	Ask for price

DPPA4 Rabbit pAb
A9238-50ul	Abclonal	50 ul	Ask for price

Polyclonal DPPA4 Antibody (Center)
APC00108G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DPPA4 (Center). This antibody is tested and proven to work in the following applications:

DPPA4 antibody
70R-12122	Fitzgerald	100 ug	EUR 403
Description: Rabbit polyclonal DPPA4 antibody

DPPA4 Antibody
47509-100ul	SAB	100ul	EUR 252

DPPA4 Antibody
3826-100	Biovision		EUR 316

DPPA4 Antibody
3826-30T	Biovision		EUR 146

DPPA4 Antibody
1-CSB-PA765975EA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DPPA4. Recognizes DPPA4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

DPPA4 antibody
70R-3293	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal DPPA4 antibody raised against the N terminal of DPPA4

Polyclonal DPPA4 Antibody (aa1-50)
APR02983G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DPPA4 (aa1-50). This antibody is tested and proven to work in the following applications:

Polyclonal DPPA4 Antibody (N-term)
AMM06955G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DPPA4 (N-term). This antibody is tested and proven to work in the following applications:

DPPA4 Polyclonal Antibody, Biotin Conjugated
A58843	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

DPPA4 Polyclonal Antibody, FITC Conjugated
A58844	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

DPPA4 Polyclonal Antibody, HRP Conjugated
A58845	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Anti-DPPA4 Antibody
A10283	BosterBio	100 ug	EUR 397
Description: Rabbit Polyclonal DPPA4 Antibody. Validated in WB and tested in Human.

DPPA4 Conjugated Antibody
C47509	SAB	100ul	EUR 397

anti- DPPA4 antibody
FNab02525	FN Test	100µg	EUR 585
Immunogen: developmental pluripotency associated 4 Uniprot ID: Q7L190 Gene ID: 55211 Research Area: Stem Cells
Description: Antibody raised against DPPA4

Anti-DPPA4 antibody
PAab02525	Lifescience Market	100 ug	EUR 412

Anti-DPPA4 antibody
STJ111623	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a nuclear factor that is involved in the maintenance of pluripotency in stem cells and essential for embryogenesis. The encoded protein has a scaffold-attachment factor A/B, acinus and PIAS (SAP) domain that binds DNA and is thought to modify chromatin. Mice with a homozygous knockout of the orthologous gene die during late embryonic development or within hours after birth. Knockout embryos are normal in size at embryonic day 18.5 but exhibit skeletal and lung tissue abnormalities. This gene, when mutated, is highly expressed in embryonal carcinomas, pluripotent germ cell tumors, and other cancers and is thought to play an important role in tumor progression. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants.

Anti-DPPA4 antibody
STJ115677	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a nuclear factor that is involved in the maintenance of pluripotency in stem cells and essential for embryogenesis. The encoded protein has a scaffold-attachment factor A/B, acinus and PIAS (SAP) domain that binds DNA and is thought to modify chromatin. Mice with a homozygous knockout of the orthologous gene die during late embryonic development or within hours after birth. Knockout embryos are normal in size at embryonic day 18.5 but exhibit skeletal and lung tissue abnormalities. This gene, when mutated, is highly expressed in embryonal carcinomas, pluripotent germ cell tumors, and other cancers and is thought to play an important role in tumor progression. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants.

Anti-DPPA4 antibody
STJ115678	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a nuclear factor that is involved in the maintenance of pluripotency in stem cells and essential for embryogenesis. The encoded protein has a scaffold-attachment factor A/B, acinus and PIAS (SAP) domain that binds DNA and is thought to modify chromatin. Mice with a homozygous knockout of the orthologous gene die during late embryonic development or within hours after birth. Knockout embryos are normal in size at embryonic day 18.5 but exhibit skeletal and lung tissue abnormalities. This gene, when mutated, is highly expressed in embryonal carcinomas, pluripotent germ cell tumors, and other cancers and is thought to play an important role in tumor progression. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants.

Anti-DPPA4 antibody
STJ192186	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to DPPA4

DPPA4 siRNA
20-abx914576	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DPPA4 siRNA
20-abx914577	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-Dppa4
YF-PA19622	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Dppa4

anti-Dppa4
YF-PA19623	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Dppa4

anti-Dppa4
YF-PA19624	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Dppa4

anti-Dppa4
YF-PA19625	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Dppa4

DPPA4 Antibody, HRP conjugated
1-CSB-PA765975EB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DPPA4. Recognizes DPPA4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DPPA4 Antibody, FITC conjugated
1-CSB-PA765975EC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DPPA4. Recognizes DPPA4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DPPA4 Antibody, Biotin conjugated
1-CSB-PA765975ED01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DPPA4. Recognizes DPPA4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DPPA4 Blocking Peptide
33R-10939	Fitzgerald	50 ug	EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DPPA4 antibody, catalog no. 70R-12122

DPPA4 Blocking Peptide
33R-6210	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DPPA4 antibody, catalog no. 70R-3293

DPPA4 Blocking Peptide
3826BP-50	Biovision		EUR 153

DPPA4 cloning plasmid
CSB-CL765975HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 885 Sequence: atggagaaggcaaaaggcaaggagtggacctccacagagaagtcgagggaagaggatcagcaggcttctaatcaaccaaattcaattgctttgccaggaacatcagcaaagagaaccaaagaaaaaatgtctgtcaaaggcagtaaagtgctctgccctaagaaaaaggcagagca Show more
Description: A cloning plasmid for the DPPA4 gene.

DPPA4 protein (His tag)
80R-2904	Fitzgerald	100 ug	EUR 424
Description: Purified recombinant DPPA4 protein (His tag)

Human DPPA4 ELISA KIT
ELI-09401h	Lifescience Market	96 Tests	EUR 824

Mouse Dppa4 ELISA KIT
ELI-09402m	Lifescience Market	96 Tests	EUR 865

DPPA4 ELISA KIT|Human
EF009215	Lifescience Market	96 Tests	EUR 689

Mouse DPPA4 shRNA Plasmid
20-abx978001	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human DPPA4 shRNA Plasmid
20-abx960560	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DPPA4 Recombinant Protein (Human)
RP009781	ABM	100 ug	Ask for price

DPPA4 Recombinant Protein (Mouse)
RP129977	ABM	100 ug	Ask for price

DPPA4 Recombinant Protein (Mouse)
RP129980	ABM	100 ug	Ask for price

Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody
abx028023-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody
abx028023-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody
20-abx124682	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody
20-abx301459	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody
abx232525-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DPPA4 ORF Vector (Human) (pORF)
ORF003261	ABM	1.0 ug DNA	EUR 95

Dppa4 ORF Vector (Mouse) (pORF)
ORF043327	ABM	1.0 ug DNA	EUR 506

Dppa4 ORF Vector (Mouse) (pORF)
ORF043328	ABM	1.0 ug DNA	EUR 506

Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody (HRP)
20-abx308169	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody (FITC)
20-abx308170	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody (Biotin)
20-abx308171	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

DPPA4 sgRNA CRISPR Lentivector set (Human)
K0628801	ABM	3 x 1.0 ug	EUR 339

Dppa4 sgRNA CRISPR Lentivector set (Mouse)
K4938401	ABM	3 x 1.0 ug	EUR 339

DPPA4 sgRNA CRISPR Lentivector (Human) (Target 1)
K0628802	ABM	1.0 ug DNA	EUR 154

DPPA4 sgRNA CRISPR Lentivector (Human) (Target 2)
K0628803	ABM	1.0 ug DNA	EUR 154

DPPA4 sgRNA CRISPR Lentivector (Human) (Target 3)
K0628804	ABM	1.0 ug DNA	EUR 154

Dppa4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4938402	ABM	1.0 ug DNA	EUR 154

Dppa4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4938403	ABM	1.0 ug DNA	EUR 154

Dppa4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4938404	ABM	1.0 ug DNA	EUR 154

DPPA4 Protein Vector (Mouse) (pPB-C-His)
PV173306	ABM	500 ng	EUR 603

DPPA4 Protein Vector (Mouse) (pPB-N-His)
PV173307	ABM	500 ng	EUR 603

DPPA4 Protein Vector (Mouse) (pPM-C-HA)
PV173308	ABM	500 ng	EUR 603

DPPA4 Protein Vector (Mouse) (pPM-C-His)
PV173309	ABM	500 ng	EUR 603

DPPA4 Protein Vector (Mouse) (pPB-C-His)
PV173310	ABM	500 ng	EUR 603

DPPA4 Protein Vector (Mouse) (pPB-N-His)
PV173311	ABM	500 ng	EUR 603

DPPA4 Protein Vector (Mouse) (pPM-C-HA)
PV173312	ABM	500 ng	EUR 603

DPPA4 Protein Vector (Mouse) (pPM-C-His)
PV173313	ABM	500 ng	EUR 603

DPPA4 Protein Vector (Human) (pPB-C-His)
PV013041	ABM	500 ng	EUR 329

DPPA4 Protein Vector (Human) (pPB-N-His)
PV013042	ABM	500 ng	EUR 329

DPPA4 Protein Vector (Human) (pPM-C-HA)
PV013043	ABM	500 ng	EUR 329

DPPA4 Protein Vector (Human) (pPM-C-His)
PV013044	ABM	500 ng	EUR 329

Recombinant Human DPPA4 Protein, His, E.coli-1mg
QP11699-1mg	EnQuireBio	1mg	EUR 3655

Recombinant Human DPPA4 Protein, His, E.coli-20ug
QP11699-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human DPPA4 Protein, His, E.coli-5ug
QP11699-5ug	EnQuireBio	5ug	EUR 155

Dppa4 3'UTR GFP Stable Cell Line
TU155370	ABM	1.0 ml	Ask for price

Dppa4 3'UTR Luciferase Stable Cell Line
TU105370	ABM	1.0 ml	Ask for price

DPPA4 3'UTR GFP Stable Cell Line
TU056286	ABM	1.0 ml	EUR 1521

DPPA4 3'UTR Luciferase Stable Cell Line
TU006286	ABM	1.0 ml	EUR 1521

DPPA4 Developmental Pluripotency Associated 4 Human Recombinant Protein
PROTQ7L190	BosterBio	Regular: 20ug	EUR 317
Description: DPPA4 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 327 amino acids (1-304) and having a molecular mass of 35.9kDa.;DPPA4 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

DPPA4 Rabbit Polyclonal Antibody