THOP1 Rabbit Polyclonal Antibody

THOP1 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

THOP1 Polyclonal Antibody
ABP60676-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human THOP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of THOP1 from Human, Mouse, Rat. This THOP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human THOP1 protein
THOP1 Polyclonal Antibody
ABP60676-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human THOP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of THOP1 from Human, Mouse, Rat. This THOP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human THOP1 protein
THOP1 Polyclonal Antibody
ES11004-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against THOP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
THOP1 Polyclonal Antibody
ES11004-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against THOP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit
DLR-THOP1-Hu-48T 48T
EUR 517
  • Should the Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thimet Oligopeptidase 1 (THOP1) in samples from tissue homogenates or other biological fluids.
Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit
DLR-THOP1-Hu-96T 96T
EUR 673
  • Should the Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thimet Oligopeptidase 1 (THOP1) in samples from tissue homogenates or other biological fluids.
Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit
RDR-THOP1-Hu-48Tests 48 Tests
EUR 544
Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit
RDR-THOP1-Hu-96Tests 96 Tests
EUR 756
Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit
RD-THOP1-Hu-48Tests 48 Tests
EUR 521
Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit
RD-THOP1-Hu-96Tests 96 Tests
EUR 723
THOP1 Rabbit pAb
A8756-100ul 100 ul
EUR 308
THOP1 Rabbit pAb
A8756-200ul 200 ul
EUR 459
THOP1 Rabbit pAb
A8756-20ul 20 ul
EUR 183
THOP1 Rabbit pAb
A8756-50ul 50 ul
EUR 223
THOP1 antibody
70R-20813 50 ul
EUR 435
Description: Rabbit polyclonal THOP1 antibody
THOP1 Antibody
47258-100ul 100ul
EUR 252
THOP1 antibody
10R-6062 100 ul
EUR 726
Description: Mouse monoclonal THOP1 antibody
THOP1 Antibody
1-CSB-PA023508GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against THOP1. Recognizes THOP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
Polyclonal THOP1 Antibody - C-terminal region
APR13730G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human THOP1 - C-terminal region. This antibody is tested and proven to work in the following applications:
THOP1 Conjugated Antibody
C47258 100ul
EUR 397
anti- THOP1 antibody
FNab08671 100µg
EUR 548.75
  • Immunogen: thimet oligopeptidase 1
  • Uniprot ID: P52888
  • Gene ID: 7064
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against THOP1
Anti-THOP1 antibody
PAab08671 100 ug
EUR 386
Anti-THOP1 antibody
STJ111402 100 µl
EUR 277
Description: The protein encoded by this gene is a kininase that uses zinc as a cofactor. The encoded oligopeptidase cleaves cytosolic peptides, making them unavailable for display on antigen-presenting cells. This protein also cleaves neuropeptides under 20 aa in length and can degrade beta-amyloid precursor protein to amyloidogenic peptides.
Anti-THOP1 antibody
STJ192162 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to THOP1
Thop1/ Rat Thop1 ELISA Kit
ELI-04311r 96 Tests
EUR 886
THOP1 siRNA
20-abx905563
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
THOP1 siRNA
20-abx936717
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
THOP1 siRNA
20-abx936718
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pOTB7-THOP1
PVT18397 2 ug
EUR 258
Thimet Oligopeptidase (THOP1) Antibody
20-abx124019
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Thimet Oligopeptidase (THOP1) Antibody
abx122858-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Thimet Oligopeptidase (THOP1) Antibody
abx238671-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
THOP1 cloning plasmid
CSB-CL023508HU1-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2070
  • Sequence: atgaagccccccgcagcctgtgcaggagacatggcggacgcagcatctccgtgctctgtggtaaacgacctgcggtgggacctgagtgcccagcagatagaggagcgcaccagggagctcatcgagcagaccaagcgcgtgtatgaccaggttggcacccaggagtttgaggacg
  • Show more
Description: A cloning plasmid for the THOP1 gene.
THOP1 cloning plasmid
CSB-CL023508HU2-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2070
  • Sequence: atgaagccccccgcagcctgtgcaggagacatggcggacgcagcatctccgtgctctgtggtaaacgacctgcggtgggacctgagtgcccagcagatagaggagcgcaccagggagctcatcgagcagaccaagcgcgtgtatgaccaggttggcacccaggagtttgaggacg
  • Show more
Description: A cloning plasmid for the THOP1 gene.
pCMV-SPORT6-THOP1
PVT14316 2 ug
EUR 495
Thimet Oligopeptidase 1 (THOP1) Antibody
20-abx116946
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Thimet Oligopeptidase 1 (THOP1) Antibody
20-abx128876
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Thimet Oligopeptidase 1 (THOP1) Antibody
20-abx174749
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig)
4-PAH027Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THOP1 (Asn451~Thr597)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1)
Human THOP1 ELISA Kit
ELA-E13023h 96 Tests
EUR 824
THOP1 ELISA KIT|Human
EF005171 96 Tests
EUR 689
Mouse THOP1 shRNA Plasmid
20-abx974074
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat THOP1 shRNA Plasmid
20-abx986267
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human THOP1 shRNA Plasmid
20-abx954834
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
THOP1 Recombinant Protein (Rat)
RP233045 100 ug Ask for price
THOP1 Recombinant Protein (Human)
RP031498 100 ug Ask for price
THOP1 Recombinant Protein (Human)
RP031501 100 ug Ask for price
THOP1 Recombinant Protein (Mouse)
RP178619 100 ug Ask for price
Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), APC
4-PAH027Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THOP1 (Asn451~Thr597)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with APC.
Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), Biotinylated
4-PAH027Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THOP1 (Asn451~Thr597)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with Biotin.
Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), Cy3
4-PAH027Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THOP1 (Asn451~Thr597)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with Cy3.
Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), FITC
4-PAH027Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THOP1 (Asn451~Thr597)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with FITC.
Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), HRP
4-PAH027Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THOP1 (Asn451~Thr597)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with HRP.
Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), PE
4-PAH027Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THOP1 (Asn451~Thr597)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with PE.
Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), APC-Cy7
4-PAH027Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THOP1 (Asn451~Thr597)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with APC-Cy7.
Thop1 ORF Vector (Rat) (pORF)
ORF077683 1.0 ug DNA
EUR 506
THOP1 ORF Vector (Human) (pORF)
ORF010500 1.0 ug DNA
EUR 95
THOP1 ORF Vector (Human) (pORF)
ORF010501 1.0 ug DNA
EUR 95
Thop1 ORF Vector (Mouse) (pORF)
ORF059541 1.0 ug DNA
EUR 506
Recombinant Thimet Oligopeptidase 1 (THOP1)
4-RPH027Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P52888
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.5kDa
  • Isoelectric Point: 5.8
Description: Recombinant Human Thimet Oligopeptidase 1 expressed in: E.coli
THOP1 ELISA Kit (Human) (OKCD09023)
OKCD09023 96 Wells
EUR 975
Description: Description of target: The function of this protein remains unknown.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.63ng/mL
THOP1 ELISA Kit (Human) (OKEH02284)
OKEH02284 96 Wells
EUR 662
Description: Description of target: The protein encoded by this gene is a kininase that uses zinc as a cofactor. The encoded oligopeptidase cleaves cytosolic peptides, making them unavailable for display on antigen-presenting cells. This protein also cleaves neuropeptides under 20 aa in length and can degrade beta-amyloid precursor protein to amyloidogenic peptides.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.13 ng/mL
THOP1 ELISA Kit (Mouse) (OKEH05571)
OKEH05571 96 Wells
EUR 779
Description: Description of target: Involved in the metabolism of neuropeptides under 20 amino acid residues long. Involved in cytoplasmic peptide degradation. Able to degrade the beta-amyloid precursor protein and generate amyloidogenic fragments.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.6 pg/mL
THOP1 ELISA Kit (Bovine) (OKEH07898)
OKEH07898 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
THOP1 ELISA Kit (Pig) (OKEH07899)
OKEH07899 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
Human Thimet Oligopeptidase 1 (THOP1) Protein
20-abx166973
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Thimet Oligopeptidase (THOP1) ELISA Kit
abx250757-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Thop1/ Thimet oligopeptidase ELISA Kit
E1468Mo 1 Kit
EUR 632
Human THOP1/ Thimet oligopeptidase ELISA Kit
E2493Hu 1 Kit
EUR 605
Human THOP1(Thimet oligopeptidase) ELISA Kit
EH1476 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: P52888
  • Alias: THOP1/Thimet oligopeptidase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Bovine Thimet oligopeptidase, THOP1 ELISA KIT
ELI-04308b 96 Tests
EUR 928
Human Thimet oligopeptidase, THOP1 ELISA KIT
ELI-04309h 96 Tests
EUR 824
Porcine Thimet oligopeptidase, THOP1 ELISA KIT
ELI-04310p 96 Tests
EUR 928
Mouse Thimet oligopeptidase, Thop1 ELISA KIT
ELI-04312m 96 Tests
EUR 865
Cow Thimet Oligopeptidase (THOP1) ELISA Kit
abx516300-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Thimet Oligopeptidase (THOP1) ELISA Kit
abx516302-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Pig Thimet Oligopeptidase (THOP1) ELISA Kit
abx516303-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rat Thimet Oligopeptidase (THOP1) ELISA Kit
abx516304-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Thop1 sgRNA CRISPR Lentivector set (Mouse)
K4959601 3 x 1.0 ug
EUR 339
Thop1 sgRNA CRISPR Lentivector set (Rat)
K7008501 3 x 1.0 ug
EUR 339
THOP1 sgRNA CRISPR Lentivector set (Human)
K2370701 3 x 1.0 ug
EUR 339
Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit
20-abx153279
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Recombinant Human Thimet Oligopeptidase/THOP1 (C-6His)
C179-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 100mM NaCl, 10% Glycerol, pH 7.0.
Recombinant Human Thimet Oligopeptidase/THOP1 (C-6His)
C179-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 100mM NaCl, 10% Glycerol, pH 7.0.
Recombinant Human Thimet Oligopeptidase/THOP1 (C-6His)
C179-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 100mM NaCl, 10% Glycerol, pH 7.0.
Recombinant Human Thimet Oligopeptidase/THOP1 (C-6His)
C179-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 100mM NaCl, 10% Glycerol, pH 7.0.
Human Thimet Oligopeptidase 1 (THOP1) CLIA Kit
20-abx495357
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

THOP1 Rabbit Polyclonal Antibody