THOP1 Rabbit Polyclonal Antibody
THOP1 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
THOP1 Polyclonal Antibody |
ABP60676-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human THOP1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of THOP1 from Human, Mouse, Rat. This THOP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human THOP1 protein |
THOP1 Polyclonal Antibody |
ABP60676-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human THOP1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of THOP1 from Human, Mouse, Rat. This THOP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human THOP1 protein |
THOP1 Polyclonal Antibody |
ES11004-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against THOP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
THOP1 Polyclonal Antibody |
ES11004-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against THOP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit |
DLR-THOP1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Thimet Oligopeptidase 1 (THOP1) in samples from tissue homogenates or other biological fluids. |
Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit |
DLR-THOP1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Thimet Oligopeptidase 1 (THOP1) in samples from tissue homogenates or other biological fluids. |
Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit |
RDR-THOP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit |
RDR-THOP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit |
RD-THOP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit |
RD-THOP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
THOP1 Rabbit pAb |
A8756-100ul |
Abclonal |
100 ul |
EUR 308 |
THOP1 Rabbit pAb |
A8756-200ul |
Abclonal |
200 ul |
EUR 459 |
THOP1 Rabbit pAb |
A8756-20ul |
Abclonal |
20 ul |
EUR 183 |
THOP1 Rabbit pAb |
A8756-50ul |
Abclonal |
50 ul |
EUR 223 |
THOP1 antibody |
70R-20813 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal THOP1 antibody |
THOP1 Antibody |
47258-100ul |
SAB |
100ul |
EUR 252 |
THOP1 antibody |
10R-6062 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal THOP1 antibody |
THOP1 Antibody |
1-CSB-PA023508GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against THOP1. Recognizes THOP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Polyclonal THOP1 Antibody - C-terminal region |
APR13730G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human THOP1 - C-terminal region. This antibody is tested and proven to work in the following applications: |
THOP1 Conjugated Antibody |
C47258 |
SAB |
100ul |
EUR 397 |
anti- THOP1 antibody |
FNab08671 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: thimet oligopeptidase 1
- Uniprot ID: P52888
- Gene ID: 7064
- Research Area: Cardiovascular, Metabolism
|
Description: Antibody raised against THOP1 |
Anti-THOP1 antibody |
STJ111402 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a kininase that uses zinc as a cofactor. The encoded oligopeptidase cleaves cytosolic peptides, making them unavailable for display on antigen-presenting cells. This protein also cleaves neuropeptides under 20 aa in length and can degrade beta-amyloid precursor protein to amyloidogenic peptides. |
Anti-THOP1 antibody |
STJ192162 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to THOP1 |
THOP1 siRNA |
20-abx905563 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
THOP1 siRNA |
20-abx936717 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
THOP1 siRNA |
20-abx936718 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Thimet Oligopeptidase (THOP1) Antibody |
20-abx124019 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Thimet Oligopeptidase (THOP1) Antibody |
abx122858-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Thimet Oligopeptidase (THOP1) Antibody |
abx238671-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
THOP1 cloning plasmid |
CSB-CL023508HU1-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2070
- Sequence: atgaagccccccgcagcctgtgcaggagacatggcggacgcagcatctccgtgctctgtggtaaacgacctgcggtgggacctgagtgcccagcagatagaggagcgcaccagggagctcatcgagcagaccaagcgcgtgtatgaccaggttggcacccaggagtttgaggacg
- Show more
|
Description: A cloning plasmid for the THOP1 gene. |
THOP1 cloning plasmid |
CSB-CL023508HU2-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2070
- Sequence: atgaagccccccgcagcctgtgcaggagacatggcggacgcagcatctccgtgctctgtggtaaacgacctgcggtgggacctgagtgcccagcagatagaggagcgcaccagggagctcatcgagcagaccaagcgcgtgtatgaccaggttggcacccaggagtttgaggacg
- Show more
|
Description: A cloning plasmid for the THOP1 gene. |
Thimet Oligopeptidase 1 (THOP1) Antibody |
20-abx116946 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Thimet Oligopeptidase 1 (THOP1) Antibody |
20-abx128876 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Thimet Oligopeptidase 1 (THOP1) Antibody |
20-abx174749 |
Abbexa |
|
|
|
Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig) |
4-PAH027Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THOP1 (Asn451~Thr597)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1) |
Mouse THOP1 shRNA Plasmid |
20-abx974074 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat THOP1 shRNA Plasmid |
20-abx986267 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human THOP1 shRNA Plasmid |
20-abx954834 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
THOP1 Recombinant Protein (Rat) |
RP233045 |
ABM |
100 ug |
Ask for price |
THOP1 Recombinant Protein (Human) |
RP031498 |
ABM |
100 ug |
Ask for price |
THOP1 Recombinant Protein (Human) |
RP031501 |
ABM |
100 ug |
Ask for price |
THOP1 Recombinant Protein (Mouse) |
RP178619 |
ABM |
100 ug |
Ask for price |
Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), APC |
4-PAH027Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THOP1 (Asn451~Thr597)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with APC. |
Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), Biotinylated |
4-PAH027Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THOP1 (Asn451~Thr597)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with Biotin. |
Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), Cy3 |
4-PAH027Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THOP1 (Asn451~Thr597)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with Cy3. |
Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), FITC |
4-PAH027Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THOP1 (Asn451~Thr597)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with FITC. |
Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), HRP |
4-PAH027Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THOP1 (Asn451~Thr597)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with HRP. |
Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), PE |
4-PAH027Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THOP1 (Asn451~Thr597)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with PE. |
Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), APC-Cy7 |
4-PAH027Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THOP1 (Asn451~Thr597)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with APC-Cy7. |
Thop1 ORF Vector (Rat) (pORF) |
ORF077683 |
ABM |
1.0 ug DNA |
EUR 506 |
THOP1 ORF Vector (Human) (pORF) |
ORF010500 |
ABM |
1.0 ug DNA |
EUR 95 |
THOP1 ORF Vector (Human) (pORF) |
ORF010501 |
ABM |
1.0 ug DNA |
EUR 95 |
Thop1 ORF Vector (Mouse) (pORF) |
ORF059541 |
ABM |
1.0 ug DNA |
EUR 506 |
Recombinant Thimet Oligopeptidase 1 (THOP1) |
4-RPH027Hu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P52888
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 20.5kDa
- Isoelectric Point: 5.8
|
Description: Recombinant Human Thimet Oligopeptidase 1 expressed in: E.coli |
THOP1 ELISA Kit (Human) (OKCD09023) |
OKCD09023 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: The function of this protein remains unknown.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.63ng/mL |
THOP1 ELISA Kit (Human) (OKEH02284) |
OKEH02284 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: The protein encoded by this gene is a kininase that uses zinc as a cofactor. The encoded oligopeptidase cleaves cytosolic peptides, making them unavailable for display on antigen-presenting cells. This protein also cleaves neuropeptides under 20 aa in length and can degrade beta-amyloid precursor protein to amyloidogenic peptides.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.13 ng/mL |
THOP1 ELISA Kit (Mouse) (OKEH05571) |
OKEH05571 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Involved in the metabolism of neuropeptides under 20 amino acid residues long. Involved in cytoplasmic peptide degradation. Able to degrade the beta-amyloid precursor protein and generate amyloidogenic fragments.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.6 pg/mL |
THOP1 ELISA Kit (Bovine) (OKEH07898) |
OKEH07898 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
THOP1 ELISA Kit (Pig) (OKEH07899) |
OKEH07899 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
Human Thimet Oligopeptidase 1 (THOP1) Protein |
20-abx166973 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Thimet Oligopeptidase (THOP1) ELISA Kit |
abx250757-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Thop1/ Thimet oligopeptidase ELISA Kit |
E1468Mo |
Sunlong |
1 Kit |
EUR 632 |
Human THOP1/ Thimet oligopeptidase ELISA Kit |
E2493Hu |
Sunlong |
1 Kit |
EUR 605 |
Human THOP1(Thimet oligopeptidase) ELISA Kit |
EH1476 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.312-20 ng/ml
- Uniprot ID: P52888
- Alias: THOP1/Thimet oligopeptidase
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Bovine Thimet oligopeptidase, THOP1 ELISA KIT |
ELI-04308b |
Lifescience Market |
96 Tests |
EUR 928 |
Human Thimet oligopeptidase, THOP1 ELISA KIT |
ELI-04309h |
Lifescience Market |
96 Tests |
EUR 824 |
Porcine Thimet oligopeptidase, THOP1 ELISA KIT |
ELI-04310p |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Thimet oligopeptidase, Thop1 ELISA KIT |
ELI-04312m |
Lifescience Market |
96 Tests |
EUR 865 |
Cow Thimet Oligopeptidase (THOP1) ELISA Kit |
abx516300-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Thimet Oligopeptidase (THOP1) ELISA Kit |
abx516302-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Pig Thimet Oligopeptidase (THOP1) ELISA Kit |
abx516303-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Thimet Oligopeptidase (THOP1) ELISA Kit |
abx516304-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Thop1 sgRNA CRISPR Lentivector set (Mouse) |
K4959601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Thop1 sgRNA CRISPR Lentivector set (Rat) |
K7008501 |
ABM |
3 x 1.0 ug |
EUR 339 |
THOP1 sgRNA CRISPR Lentivector set (Human) |
K2370701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit |
20-abx153279 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Recombinant Human Thimet Oligopeptidase/THOP1 (C-6His) |
C179-10ug |
Novoprotein |
10ug |
EUR 202 |
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 100mM NaCl, 10% Glycerol, pH 7.0. |
Recombinant Human Thimet Oligopeptidase/THOP1 (C-6His) |
C179-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 100mM NaCl, 10% Glycerol, pH 7.0. |
Recombinant Human Thimet Oligopeptidase/THOP1 (C-6His) |
C179-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 100mM NaCl, 10% Glycerol, pH 7.0. |
Recombinant Human Thimet Oligopeptidase/THOP1 (C-6His) |
C179-50ug |
Novoprotein |
50ug |
EUR 496 |
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 100mM NaCl, 10% Glycerol, pH 7.0. |
Human Thimet Oligopeptidase 1 (THOP1) CLIA Kit |
20-abx495357 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
THOP1 Rabbit Polyclonal Antibody