PON3 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

PON3 Polyclonal Antibody
ABP59970-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human PON3 protein Applications tips:
Description: A polyclonal antibody for detection of PON3 from Human, Mouse, Rat. This PON3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PON3 protein

PON3 Polyclonal Antibody
ABP59970-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human PON3 protein Applications tips:
Description: A polyclonal antibody for detection of PON3 from Human, Mouse, Rat. This PON3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PON3 protein

PON3 Polyclonal Antibody
ABP59970-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human PON3 protein Applications tips:
Description: A polyclonal antibody for detection of PON3 from Human, Mouse, Rat. This PON3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PON3 protein

PON3 Polyclonal Antibody
ES11115-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PON3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PON3 Polyclonal Antibody
ES11115-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PON3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Paraoxonase 3 (PON3) ELISA Kit
DLR-PON3-Hu-48T	DL Develop	48T	EUR 517
Should the Human Paraoxonase 3 (PON3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Paraoxonase 3 (PON3) in samples from serum, plasma or other biological fluids.

Human Paraoxonase 3 (PON3) ELISA Kit
DLR-PON3-Hu-96T	DL Develop	96T	EUR 673
Should the Human Paraoxonase 3 (PON3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Paraoxonase 3 (PON3) in samples from serum, plasma or other biological fluids.

Human Paraoxonase 3 (PON3) ELISA Kit
RDR-PON3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Paraoxonase 3 (PON3) ELISA Kit
RDR-PON3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Paraoxonase 3 (PON3) ELISA Kit
RD-PON3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Paraoxonase 3 (PON3) ELISA Kit
RD-PON3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

PON3 Rabbit pAb
A16418-100ul	Abclonal	100 ul	EUR 308

PON3 Rabbit pAb
A16418-200ul	Abclonal	200 ul	EUR 459

PON3 Rabbit pAb
A16418-20ul	Abclonal	20 ul	EUR 183

PON3 Rabbit pAb
A16418-50ul	Abclonal	50 ul	EUR 223

PON3 Polyclonal Conjugated Antibody
C29835	SAB	100ul	EUR 397

PON3 antibody
10R-8555	Fitzgerald	100 ul	EUR 393
Description: Mouse monoclonal PON3 antibody

PON3 Antibody
39919-100ul	SAB	100ul	EUR 390

PON3 Antibody
1-CSB-PA614883LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

PON3 Antibody
DF8108	Affbiotech	200ul	EUR 304
Description: PON3 Antibody detects endogenous levels of total PON3.

PON3 antibody
70R-6930	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal PON3 antibody raised against the middle region of PON3

PON3 antibody
70R-7456	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal PON3 antibody raised against the middle region of PON3

PON3 Antibody
ABD8108	Lifescience Market	100 ug	EUR 438

PON3 Antibody
ABD8148	Lifescience Market	100 ug	EUR 438

Polyclonal PON3 Antibody (N-term)
APR10907G	Leading Biology	0.1ml	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PON3 (N-term). This antibody is tested and proven to work in the following applications:

PON3 Polyclonal Antibody, HRP Conjugated
A68840	EpiGentek	100 ?g	EUR 628.55
Description: reagents widely cited

PON3 Polyclonal Antibody, FITC Conjugated
A68841	EpiGentek	100 ?g	EUR 628.55
Description: Ask the seller for details

PON3 Polyclonal Antibody, Biotin Conjugated
A68842	EpiGentek	100 ?g	EUR 628.55
Description: The best epigenetics products

Paraoxonase 3 (PON3) Polyclonal Antibody (Human)
4-PAD178Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON3 (Gly2~Leu354) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3)

Anti-PON3 antibody
STJ118858	St John's Laboratory	100 µl	EUR 277

Anti-PON3 antibody
STJ192273	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PON3

Pon3/ Rat Pon3 ELISA Kit
ELI-12743r	Lifescience Market	96 Tests	EUR 886

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), APC
4-PAD178Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON3 (Gly2~Leu354) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with APC.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), Biotinylated
4-PAD178Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON3 (Gly2~Leu354) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with Biotin.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), Cy3
4-PAD178Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON3 (Gly2~Leu354) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with Cy3.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), FITC
4-PAD178Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON3 (Gly2~Leu354) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with FITC.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), HRP
4-PAD178Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON3 (Gly2~Leu354) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with HRP.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), PE
4-PAD178Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON3 (Gly2~Leu354) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with PE.

Rabbit Paraoxonase 3 (PON3) ELISA Kit
abx363833-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

PON3 siRNA
20-abx904139	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PON3 siRNA
20-abx929267	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PON3 siRNA
20-abx929268	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-PON3
YF-PA13885	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to PON3

anti-PON3
YF-PA13886	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to PON3

PON3 Antibody, HRP conjugated
1-CSB-PA614883LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PON3 Antibody, FITC conjugated
1-CSB-PA614883LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PON3 Antibody, Biotin conjugated
1-CSB-PA614883LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Paraoxonase 3 (PON3) Antibody
20-abx128083	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Paraoxonase 3 (PON3) Antibody
abx037062-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Paraoxonase 3 (PON3) Antibody
20-abx173952	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), APC-Cy7
4-PAD178Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON3 (Gly2~Leu354) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with APC-Cy7.

PON3 Blocking Peptide
33R-2947	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PON3 antibody, catalog no. 70R-6930

PON3 Blocking Peptide
33R-7223	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PON3 antibody, catalog no. 70R-7456

PON3 Blocking Peptide
DF8108-BP	Affbiotech	1mg	EUR 195

PON3 cloning plasmid
CSB-CL614883HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1065 Sequence: atggggaagctcgtggcgctggtcctgctgggggtcggcctgtccttagtcggggagatgttcctggcgtttagagaaagggtgaatgcctctcgagaagtggagccagtagaacctgaaaactgccaccttattgaggaacttgaaaatggctctgaagatattgatatacttc Show more
Description: A cloning plasmid for the PON3 gene.

Rabbit Serum paraoxonase/lactonase 3, PON3 ELISA KIT
ELI-45533Ra	Lifescience Market	96 Tests	EUR 928

Serum Paraoxonase / Lactonase 3 (PON3) Antibody
abx034015-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Serum Paraoxonase / Lactonase 3 (PON3) Antibody
abx034015-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Serum Paraoxonase / Lactonase 3 (PON3) Antibody
20-abx334317	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Active Paraoxonase 3 (PON3)
4-APD178Hu01	Cloud-Clone	EUR 942.24 EUR 355.00 EUR 3258.40 EUR 1152.80 EUR 2205.60 EUR 694.00 EUR 7996.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q15166 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 43.2kDa Isoelectric Point: 5.2
Description: Recombinant Human Paraoxonase 3 expressed in: E.coli

Human PON3 ELISA Kit
ELA-E10065h	Lifescience Market	96 Tests	EUR 824

PON3 ELISA KIT|Human
EF001831	Lifescience Market	96 Tests	EUR 689

Rat PON3 shRNA Plasmid
20-abx989703	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PON3 shRNA Plasmid
20-abx953649	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse PON3 shRNA Plasmid
20-abx983070	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Recombinant Paraoxonase 3 (PON3)
4-RPD178Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q15166 Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 43.2kDa Isoelectric Point: 5.2
Description: Recombinant Human Paraoxonase 3 expressed in: E.coli

PON3 Recombinant Protein (Human)
RP024151	ABM	100 ug	Ask for price

PON3 Recombinant Protein (Mouse)
RP163475	ABM	100 ug	Ask for price

PON3 Recombinant Protein (Rat)
RP221435	ABM	100 ug	Ask for price

Monoclonal PON3 Antibody (clone 5G11), Clone: 5G11
AMR09422G	Leading Biology	0.05ml	EUR 484
Description: A Monoclonal antibody against Human PON3 (clone 5G11). The antibodies are raised in Mouse and are from clone 5G11. This antibody is applicable in WB and IHC-P

Serum Paraoxonase / Lactonase 3 (PON3) Antibody (HRP)
20-abx337658	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Serum Paraoxonase / Lactonase 3 (PON3) Antibody (FITC)
20-abx337659	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Serum Paraoxonase / Lactonase 3 (PON3) Antibody (Biotin)
20-abx337660	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Paraoxonase 3 (PON3) Protein
20-abx166722	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

anti-PON3 (Paraoxonase 3) (5G11)
LF-MA0273	Abfrontier	100 ul	EUR 334
Description: Mouse monoclonal to PON3 (Paraoxonase 3)

Pon3 ORF Vector (Rat) (pORF)
ORF073813	ABM	1.0 ug DNA	EUR 506

PON3 ORF Vector (Human) (pORF)
ORF008051	ABM	1.0 ug DNA	EUR 95

Pon3 ORF Vector (Mouse) (pORF)
ORF054493	ABM	1.0 ug DNA	EUR 506

PON3 ELISA Kit (Human) (OKAN06251)
OKAN06251	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene is a member of the paraoxonase family and lies in a cluster on chromosome 7 with the other two family members. The encoded protein is secreted into the bloodstream and associates with high-density lipoprotein (HDL). The protein also rapidly hydrolyzes lactones and can inhibit the oxidation of low-density lipoprotein (LDL), a function that is believed to slow the initiation and progression of atherosclerosis. Alternatively spliced variants which encode different protein isoforms have been described; however, only one has been fully characterized.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 37 pg/mL

PON3 ELISA Kit (Human) (OKCD08407)
OKCD08407	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene is a member of the paraoxonase family and lies in a cluster on chromosome 7 with the other two family members. The encoded protein is secreted into the bloodstream and associates with high-density lipoprotein (HDL). The protein also rapidly hydr;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 37pg/mL

PON3 ELISA Kit (Mouse) (OKEH05754)
OKEH05754	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Has low activity towards the organophosphate paraxon and aromatic carboxylic acid esters. Rapidly hydrolyzes lactones such as statin prodrugs (e.g. lovastatin). Hydrolyzes aromatic lactones and 5- or 6-member ring lactones with aliphatic substituents but not simple lactones or those with polar substituents.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.161 ng/mL

PON3 ELISA Kit (Rat) (OKEH06258)
OKEH06258	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Has low activity towards the organophosphate paraxon and aromatic carboxylic acid esters. Rapidly hydrolyzes lactones such as statin prodrugs (e.g. lovastatin). Hydrolyzes aromatic lactones and 5- or 6-member ring lactones with aliphatic substituents but not simple lactones or those with polar substituents.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.162 ng/mL

Human Paraoxonase 3 (PON3) CLIA Kit
abx196185-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Paraoxonase 3 (PON3) ELISA Kit
20-abx152644	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Paraoxonase 3 (PON3) ELISA Kit
abx250365-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Paraoxonase 3 (PON3) ELISA Kit
CSB-E15783h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Paraoxonase 3 (PON3) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Paraoxonase 3 (PON3) ELISA Kit
1-CSB-E15783h	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Paraoxonase 3 (PON3) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Pig Paraoxonase 3 (PON3) ELISA Kit
abx360901-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Paraoxonase 3 (PON3) ELISA Kit
abx359115-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Paraoxonase 3 (PON3) ELISA Kit
abx355609-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Paraoxonase 3 (PON3) Protein (Active)
20-abx651428	Abbexa	EUR 1288.00 EUR 453.00 EUR 4351.00 EUR 1567.00 EUR 871.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Paraoxonase 3 (PON3) CLIA Kit
20-abx494123	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Pon3 sgRNA CRISPR Lentivector set (Mouse)
K5033301	ABM	3 x 1.0 ug	EUR 339

Pon3 sgRNA CRISPR Lentivector set (Rat)
K7196701	ABM	3 x 1.0 ug	EUR 339

PON3 sgRNA CRISPR Lentivector set (Human)
K1688001	ABM	3 x 1.0 ug	EUR 339

Human Paraoxonase 3 ELISA Kit (PON3)
RK02116	Abclonal	96 Tests	EUR 521

Human Paraoxonase 3 (PON3) ELISA Kit
SED178Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids.

Human Paraoxonase 3 (PON3) ELISA Kit
SED178Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids.

Human Paraoxonase 3 (PON3) ELISA Kit
SED178Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids.

Human Paraoxonase 3 (PON3) ELISA Kit
SED178Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids.

Human Paraoxonase 3 (PON3) ELISA Kit
4-SED178Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Paraoxonase 3 elisa. Alternative names of the recognized antigen: Serum paraoxonase/lactonase 3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Paraoxonase 3 (PON3) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

CLIA kit for Human PON3 (Paraoxonase 3)
E-CL-H1380	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's PON3 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human PON3 . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human PON3 (Paraoxonase 3) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human PON3 (Paraoxonase 3)
E-EL-H2374	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PON3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PON3. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PON3 (Paraoxonase 3) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human PON3 (Paraoxonase 3)
ELK3696	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Paraoxonase 3 (PON3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Paraoxonase 3 Show more
Description: A sandwich ELISA kit for detection of Paraoxonase 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig Paraoxonase 3 (PON3) ELISA Kit
abx357805-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pon3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K5033302	ABM	1.0 ug DNA	EUR 154

Pon3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K5033303	ABM	1.0 ug DNA	EUR 154

Pon3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K5033304	ABM	1.0 ug DNA	EUR 154

ELISA kit for Human Paraoxonase 3 (PON3)
KTE61197-48T	Abbkine	48T	EUR 332
Members of the paraoxonase (EC 3.1.1.2) gene family, such as PON3, encode high density lipoprotein (HDL)-related glycoproteins with multienzymatic properties. (Lu et al., 2006).Lu et al. (2006) cloned PON3 from a fetal liver cDNA library. The deduced Show more
Description: Quantitative sandwich ELISA for measuring Human Paraoxonase 3 (PON3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Paraoxonase 3 (PON3)
KTE61197-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Members of the paraoxonase (EC 3.1.1.2) gene family, such as PON3, encode high density lipoprotein (HDL)-related glycoproteins with multienzymatic properties. (Lu et al., 2006).Lu et al. (2006) cloned PON3 from a fetal liver cDNA library. The deduced Show more
Description: Quantitative sandwich ELISA for measuring Human Paraoxonase 3 (PON3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Paraoxonase 3 (PON3)
KTE61197-96T	Abbkine	96T	EUR 539
Members of the paraoxonase (EC 3.1.1.2) gene family, such as PON3, encode high density lipoprotein (HDL)-related glycoproteins with multienzymatic properties. (Lu et al., 2006).Lu et al. (2006) cloned PON3 from a fetal liver cDNA library. The deduced Show more
Description: Quantitative sandwich ELISA for measuring Human Paraoxonase 3 (PON3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Pon3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7196702	ABM	1.0 ug DNA	EUR 154

Pon3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7196703	ABM	1.0 ug DNA	EUR 154

Pon3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7196704	ABM	1.0 ug DNA	EUR 154

PON3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1688002	ABM	1.0 ug DNA	EUR 154

PON3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1688003	ABM	1.0 ug DNA	EUR 154

PON3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1688004	ABM	1.0 ug DNA	EUR 154

PON3 Protein Vector (Rat) (pPB-C-His)
PV295250	ABM	500 ng	EUR 603

PON3 Protein Vector (Rat) (pPB-N-His)
PV295251	ABM	500 ng	EUR 603

PON3 Protein Vector (Rat) (pPM-C-HA)
PV295252	ABM	500 ng	EUR 603

PON3 Protein Vector (Rat) (pPM-C-His)
PV295253	ABM	500 ng	EUR 603

PON3 Protein Vector (Human) (pPB-C-His)
PV032201	ABM	500 ng	EUR 329

PON3 Protein Vector (Human) (pPB-N-His)
PV032202	ABM	500 ng	EUR 329

PON3 Protein Vector (Human) (pPM-C-HA)
PV032203	ABM	500 ng	EUR 329

PON3 Protein Vector (Human) (pPM-C-His)
PV032204	ABM	500 ng	EUR 329

PON3 Protein Vector (Mouse) (pPB-C-His)
PV217970	ABM	500 ng	EUR 603

PON3 Protein Vector (Mouse) (pPB-N-His)
PV217971	ABM	500 ng	EUR 603

PON3 Protein Vector (Mouse) (pPM-C-HA)
PV217972	ABM	500 ng	EUR 603

PON3 Protein Vector (Mouse) (pPM-C-His)
PV217973	ABM	500 ng	EUR 603

Pon3 3'UTR Luciferase Stable Cell Line
TU116713	ABM	1.0 ml	Ask for price

Pon3 3'UTR GFP Stable Cell Line
TU166713	ABM	1.0 ml	Ask for price

Pon3 3'UTR Luciferase Stable Cell Line
TU216558	ABM	1.0 ml	Ask for price

Pon3 3'UTR GFP Stable Cell Line
TU266558	ABM	1.0 ml	Ask for price

PON3 3'UTR GFP Stable Cell Line
TU068470	ABM	1.0 ml	EUR 1394

PON3 3'UTR Luciferase Stable Cell Line
TU018470	ABM	1.0 ml	EUR 1394

PON3 ELISA Kit (Human) : 96 Wells (OKEH02046)
OKEH02046	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: This gene is a member of the paraoxonase family and lies in a cluster on chromosome 7 with the other two family members. The encoded protein is secreted into the bloodstream and associates with high-density lipoprotein (HDL). The protein also rapidly hydrolyzes lactones and can inhibit the oxidation of low-density lipoprotein (LDL), a function that is believed to slow the initiation and progression of atherosclerosis. Alternatively spliced variants which encode different protein isoforms have been described; however, only one has been fully characterized. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

PON3 Rabbit Polyclonal Antibody