PON3 Rabbit Polyclonal Antibody
PON3 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
PON3 Polyclonal Antibody |
ABP59970-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PON3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PON3 from Human, Mouse, Rat. This PON3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PON3 protein |
PON3 Polyclonal Antibody |
ABP59970-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PON3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PON3 from Human, Mouse, Rat. This PON3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PON3 protein |
PON3 Polyclonal Antibody |
A68839 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: fast delivery possible |
PON3 Polyclonal Antibody |
29835-100ul |
SAB |
100ul |
EUR 252 |
PON3 Polyclonal Antibody |
29835-50ul |
SAB |
50ul |
EUR 187 |
Human Paraoxonase 3 (PON3) ELISA Kit |
DLR-PON3-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Paraoxonase 3 (PON3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Paraoxonase 3 (PON3) in samples from serum, plasma or other biological fluids. |
Human Paraoxonase 3 (PON3) ELISA Kit |
DLR-PON3-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Paraoxonase 3 (PON3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Paraoxonase 3 (PON3) in samples from serum, plasma or other biological fluids. |
Human Paraoxonase 3 (PON3) ELISA Kit |
RD-PON3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Paraoxonase 3 (PON3) ELISA Kit |
RD-PON3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Paraoxonase 3 (PON3) ELISA Kit |
RDR-PON3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Paraoxonase 3 (PON3) ELISA Kit |
RDR-PON3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
PON3 Rabbit pAb |
A16418-100ul |
Abclonal |
100 ul |
EUR 308 |
PON3 Rabbit pAb |
A16418-200ul |
Abclonal |
200 ul |
EUR 459 |
PON3 Rabbit pAb |
A16418-20ul |
Abclonal |
20 ul |
EUR 183 |
PON3 Rabbit pAb |
A16418-50ul |
Abclonal |
50 ul |
EUR 223 |
PON3 Polyclonal Conjugated Antibody |
C29835 |
SAB |
100ul |
EUR 397 |
PON3 antibody |
70R-6930 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PON3 antibody raised against the middle region of PON3 |
PON3 antibody |
70R-7456 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PON3 antibody raised against the middle region of PON3 |
PON3 Antibody |
39919-100ul |
SAB |
100ul |
EUR 390 |
PON3 antibody |
10R-8555 |
Fitzgerald |
100 ul |
EUR 393 |
Description: Mouse monoclonal PON3 antibody |
PON3 Antibody |
DF8108 |
Affbiotech |
200ul |
EUR 304 |
Description: PON3 Antibody detects endogenous levels of total PON3. |
PON3 Antibody |
1-CSB-PA614883LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500 |
Polyclonal PON3 Antibody (N-term) |
APR10907G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PON3 (N-term). This antibody is tested and proven to work in the following applications: |
PON3 Polyclonal Antibody, HRP Conjugated |
A68840 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
PON3 Polyclonal Antibody, FITC Conjugated |
A68841 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: Ask the seller for details |
PON3 Polyclonal Antibody, Biotin Conjugated |
A68842 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: The best epigenetics products |
Paraoxonase 3 (PON3) Polyclonal Antibody (Human) |
4-PAD178Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON3 (Gly2~Leu354)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3) |
Anti-PON3 antibody |
STJ192273 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PON3 |
Paraoxonase 3 (PON3) Polyclonal Antibody (Human), APC |
4-PAD178Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON3 (Gly2~Leu354)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with APC. |
Paraoxonase 3 (PON3) Polyclonal Antibody (Human), Biotinylated |
4-PAD178Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON3 (Gly2~Leu354)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with Biotin. |
Paraoxonase 3 (PON3) Polyclonal Antibody (Human), Cy3 |
4-PAD178Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON3 (Gly2~Leu354)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with Cy3. |
Paraoxonase 3 (PON3) Polyclonal Antibody (Human), FITC |
4-PAD178Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON3 (Gly2~Leu354)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with FITC. |
Paraoxonase 3 (PON3) Polyclonal Antibody (Human), HRP |
4-PAD178Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON3 (Gly2~Leu354)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with HRP. |
Paraoxonase 3 (PON3) Polyclonal Antibody (Human), PE |
4-PAD178Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON3 (Gly2~Leu354)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with PE. |
Rabbit Paraoxonase 3 (PON3) ELISA Kit |
abx363833-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
PON3 siRNA |
20-abx904139 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PON3 siRNA |
20-abx929267 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PON3 siRNA |
20-abx929268 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PON3 |
YF-PA13885 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to PON3 |
anti-PON3 |
YF-PA13886 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to PON3 |
Paraoxonase 3 (PON3) Antibody |
20-abx128083 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Paraoxonase 3 (PON3) Antibody |
abx037062-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Paraoxonase 3 (PON3) Antibody |
20-abx173952 |
Abbexa |
|
|
|
PON3 Antibody, HRP conjugated |
1-CSB-PA614883LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PON3 Antibody, FITC conjugated |
1-CSB-PA614883LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PON3 Antibody, Biotin conjugated |
1-CSB-PA614883LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Paraoxonase 3 (PON3) Polyclonal Antibody (Human), APC-Cy7 |
4-PAD178Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON3 (Gly2~Leu354)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with APC-Cy7. |
PON3 cloning plasmid |
CSB-CL614883HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1065
- Sequence: atggggaagctcgtggcgctggtcctgctgggggtcggcctgtccttagtcggggagatgttcctggcgtttagagaaagggtgaatgcctctcgagaagtggagccagtagaacctgaaaactgccaccttattgaggaacttgaaaatggctctgaagatattgatatacttc
- Show more
|
Description: A cloning plasmid for the PON3 gene. |
PON3 Blocking Peptide |
33R-2947 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PON3 antibody, catalog no. 70R-6930 |
PON3 Blocking Peptide |
33R-7223 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PON3 antibody, catalog no. 70R-7456 |
PON3 Blocking Peptide |
DF8108-BP |
Affbiotech |
1mg |
EUR 195 |
Rabbit Serum paraoxonase/lactonase 3, PON3 ELISA KIT |
ELI-45533Ra |
Lifescience Market |
96 Tests |
EUR 928 |
Serum Paraoxonase / Lactonase 3 (PON3) Antibody |
abx034015-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serum Paraoxonase / Lactonase 3 (PON3) Antibody |
abx034015-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serum Paraoxonase / Lactonase 3 (PON3) Antibody |
20-abx334317 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Active Paraoxonase 3 (PON3) |
4-APD178Hu01 |
Cloud-Clone |
-
EUR 942.24
-
EUR 355.00
-
EUR 3258.40
-
EUR 1152.80
-
EUR 2205.60
-
EUR 694.00
-
EUR 7996.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q15166
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 43.2kDa
- Isoelectric Point: 5.2
|
Description: Recombinant Human Paraoxonase 3 expressed in: E.coli |
Rat PON3 shRNA Plasmid |
20-abx989703 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PON3 shRNA Plasmid |
20-abx983070 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PON3 shRNA Plasmid |
20-abx953649 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Recombinant Paraoxonase 3 (PON3) |
4-RPD178Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q15166
- Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 43.2kDa
- Isoelectric Point: 5.2
|
Description: Recombinant Human Paraoxonase 3 expressed in: E.coli |
PON3 Recombinant Protein (Human) |
RP024151 |
ABM |
100 ug |
Ask for price |
PON3 Recombinant Protein (Rat) |
RP221435 |
ABM |
100 ug |
Ask for price |
PON3 Recombinant Protein (Mouse) |
RP163475 |
ABM |
100 ug |
Ask for price |
Monoclonal PON3 Antibody (clone 5G11), Clone: 5G11 |
AMR09422G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A Monoclonal antibody against Human PON3 (clone 5G11). The antibodies are raised in Mouse and are from clone 5G11. This antibody is applicable in WB and IHC-P |
Serum Paraoxonase / Lactonase 3 (PON3) Antibody (HRP) |
20-abx337658 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serum Paraoxonase / Lactonase 3 (PON3) Antibody (FITC) |
20-abx337659 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serum Paraoxonase / Lactonase 3 (PON3) Antibody (Biotin) |
20-abx337660 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human Paraoxonase 3 (PON3) Protein |
20-abx166722 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
PON3 ORF Vector (Human) (pORF) |
ORF008051 |
ABM |
1.0 ug DNA |
EUR 95 |
anti-PON3 (Paraoxonase 3) (5G11) |
LF-MA0273 |
Abfrontier |
100 ul |
EUR 334 |
Description: Mouse monoclonal to PON3 (Paraoxonase 3) |
Pon3 ORF Vector (Rat) (pORF) |
ORF073813 |
ABM |
1.0 ug DNA |
EUR 506 |
Pon3 ORF Vector (Mouse) (pORF) |
ORF054493 |
ABM |
1.0 ug DNA |
EUR 506 |
PON3 ELISA Kit (Human) (OKAN06251) |
OKAN06251 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene is a member of the paraoxonase family and lies in a cluster on chromosome 7 with the other two family members. The encoded protein is secreted into the bloodstream and associates with high-density lipoprotein (HDL). The protein also rapidly hydrolyzes lactones and can inhibit the oxidation of low-density lipoprotein (LDL), a function that is believed to slow the initiation and progression of atherosclerosis. Alternatively spliced variants which encode different protein isoforms have been described; however, only one has been fully characterized.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 37 pg/mL |
PON3 ELISA Kit (Human) (OKCD08407) |
OKCD08407 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene is a member of the paraoxonase family and lies in a cluster on chromosome 7 with the other two family members. The encoded protein is secreted into the bloodstream and associates with high-density lipoprotein (HDL). The protein also rapidly hydr;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 37pg/mL |
PON3 ELISA Kit (Mouse) (OKEH05754) |
OKEH05754 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Has low activity towards the organophosphate paraxon and aromatic carboxylic acid esters. Rapidly hydrolyzes lactones such as statin prodrugs (e.g. lovastatin). Hydrolyzes aromatic lactones and 5- or 6-member ring lactones with aliphatic substituents but not simple lactones or those with polar substituents.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.161 ng/mL |
PON3 ELISA Kit (Rat) (OKEH06258) |
OKEH06258 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Has low activity towards the organophosphate paraxon and aromatic carboxylic acid esters. Rapidly hydrolyzes lactones such as statin prodrugs (e.g. lovastatin). Hydrolyzes aromatic lactones and 5- or 6-member ring lactones with aliphatic substituents but not simple lactones or those with polar substituents.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.162 ng/mL |
Pig Paraoxonase 3 (PON3) ELISA Kit |
abx360901-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Paraoxonase 3 (PON3) Protein (Active) |
20-abx651428 |
Abbexa |
-
EUR 1288.00
-
EUR 453.00
-
EUR 4351.00
-
EUR 1567.00
-
EUR 871.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Paraoxonase 3 (PON3) ELISA Kit |
20-abx152644 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Paraoxonase 3 (PON3) CLIA Kit |
abx196185-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Paraoxonase 3 (PON3) ELISA Kit |
abx359115-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Paraoxonase 3 (PON3) ELISA Kit |
abx355609-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Paraoxonase 3 (PON3) CLIA Kit |
20-abx494123 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Paraoxonase 3 (PON3) ELISA Kit |
abx250365-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
PON3 sgRNA CRISPR Lentivector set (Human) |
K1688001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Paraoxonase 3 (PON3) ELISA Kit |
CSB-E15783h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Paraoxonase 3 (PON3) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Paraoxonase 3 (PON3) ELISA Kit |
1-CSB-E15783h |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Paraoxonase 3 (PON3) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Pon3 sgRNA CRISPR Lentivector set (Mouse) |
K5033301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pon3 sgRNA CRISPR Lentivector set (Rat) |
K7196701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Paraoxonase 3 ELISA Kit (PON3) |
RK02116 |
Abclonal |
96 Tests |
EUR 521 |
Human Paraoxonase 3 (PON3) ELISA Kit |
SED178Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids. |
Human Paraoxonase 3 (PON3) ELISA Kit |
SED178Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids. |
Human Paraoxonase 3 (PON3) ELISA Kit |
SED178Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids. |
Human Paraoxonase 3 (PON3) ELISA Kit |
SED178Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids. |
Human Paraoxonase 3 (PON3) ELISA Kit |
4-SED178Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Paraoxonase 3 elisa. Alternative names of the recognized antigen: Serum paraoxonase/lactonase 3
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Paraoxonase 3 (PON3) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
ELISA kit for Human PON3 (Paraoxonase 3) |
E-EL-H2374 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's PON3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PON3. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human PON3 (Paraoxonase 3) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human PON3 (Paraoxonase 3) |
ELK3696 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Paraoxonase 3 (PON3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Paraoxonase 3
- Show more
|
Description: A sandwich ELISA kit for detection of Paraoxonase 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Guinea pig Paraoxonase 3 (PON3) ELISA Kit |
abx357805-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
PON3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1688002 |
ABM |
1.0 ug DNA |
EUR 154 |
PON3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1688003 |
ABM |
1.0 ug DNA |
EUR 154 |
PON3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1688004 |
ABM |
1.0 ug DNA |
EUR 154 |
CLIA kit for Human PON3 (Paraoxonase 3) |
E-CL-H1380 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's PON3 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human PON3 . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human PON3 (Paraoxonase 3) in samples from Serum, Plasma, Cell supernatant |
Pon3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K5033302 |
ABM |
1.0 ug DNA |
EUR 154 |
Pon3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K5033303 |
ABM |
1.0 ug DNA |
EUR 154 |
Pon3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K5033304 |
ABM |
1.0 ug DNA |
EUR 154 |
Pon3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7196702 |
ABM |
1.0 ug DNA |
EUR 154 |
Pon3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7196703 |
ABM |
1.0 ug DNA |
EUR 154 |
Pon3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7196704 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Human Paraoxonase 3 (PON3) |
KTE61197-48T |
Abbkine |
48T |
EUR 332 |
- Members of the paraoxonase (EC 3.1.1.2) gene family, such as PON3, encode high density lipoprotein (HDL)-related glycoproteins with multienzymatic properties. (Lu et al., 2006).Lu et al. (2006) cloned PON3 from a fetal liver cDNA library. The deduced
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Paraoxonase 3 (PON3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Paraoxonase 3 (PON3) |
KTE61197-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Members of the paraoxonase (EC 3.1.1.2) gene family, such as PON3, encode high density lipoprotein (HDL)-related glycoproteins with multienzymatic properties. (Lu et al., 2006).Lu et al. (2006) cloned PON3 from a fetal liver cDNA library. The deduced
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Paraoxonase 3 (PON3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Paraoxonase 3 (PON3) |
KTE61197-96T |
Abbkine |
96T |
EUR 539 |
- Members of the paraoxonase (EC 3.1.1.2) gene family, such as PON3, encode high density lipoprotein (HDL)-related glycoproteins with multienzymatic properties. (Lu et al., 2006).Lu et al. (2006) cloned PON3 from a fetal liver cDNA library. The deduced
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Paraoxonase 3 (PON3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
PON3 Protein Vector (Human) (pPB-C-His) |
PV032201 |
ABM |
500 ng |
EUR 329 |
PON3 Protein Vector (Human) (pPB-N-His) |
PV032202 |
ABM |
500 ng |
EUR 329 |
PON3 Protein Vector (Human) (pPM-C-HA) |
PV032203 |
ABM |
500 ng |
EUR 329 |
PON3 Protein Vector (Human) (pPM-C-His) |
PV032204 |
ABM |
500 ng |
EUR 329 |
PON3 Protein Vector (Mouse) (pPB-C-His) |
PV217970 |
ABM |
500 ng |
EUR 603 |
PON3 Protein Vector (Mouse) (pPB-N-His) |
PV217971 |
ABM |
500 ng |
EUR 603 |
PON3 Protein Vector (Mouse) (pPM-C-HA) |
PV217972 |
ABM |
500 ng |
EUR 603 |
PON3 Protein Vector (Mouse) (pPM-C-His) |
PV217973 |
ABM |
500 ng |
EUR 603 |
PON3 Protein Vector (Rat) (pPB-C-His) |
PV295250 |
ABM |
500 ng |
EUR 603 |
PON3 Protein Vector (Rat) (pPB-N-His) |
PV295251 |
ABM |
500 ng |
EUR 603 |
PON3 Protein Vector (Rat) (pPM-C-HA) |
PV295252 |
ABM |
500 ng |
EUR 603 |
PON3 Protein Vector (Rat) (pPM-C-His) |
PV295253 |
ABM |
500 ng |
EUR 603 |
Pon3 3'UTR GFP Stable Cell Line |
TU166713 |
ABM |
1.0 ml |
Ask for price |
PON3 3'UTR Luciferase Stable Cell Line |
TU018470 |
ABM |
1.0 ml |
EUR 1394 |
Pon3 3'UTR Luciferase Stable Cell Line |
TU116713 |
ABM |
1.0 ml |
Ask for price |
PON3 3'UTR GFP Stable Cell Line |
TU068470 |
ABM |
1.0 ml |
EUR 1394 |
Pon3 3'UTR GFP Stable Cell Line |
TU266558 |
ABM |
1.0 ml |
Ask for price |
Pon3 3'UTR Luciferase Stable Cell Line |
TU216558 |
ABM |
1.0 ml |
Ask for price |
PON3 ELISA Kit (Human) : 96 Wells (OKEH02046) |
OKEH02046 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: This gene is a member of the paraoxonase family and lies in a cluster on chromosome 7 with the other two family members. The encoded protein is secreted into the bloodstream and associates with high-density lipoprotein (HDL). The protein also rapidly hydrolyzes lactones and can inhibit the oxidation of low-density lipoprotein (LDL), a function that is believed to slow the initiation and progression of atherosclerosis. Alternatively spliced variants which encode different protein isoforms have been described; however, only one has been fully characterized. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
PON3 Rabbit Polyclonal Antibody