PI16 Rabbit Polyclonal Antibody

PI16 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

PI16 Polyclonal Antibody

ABP59904-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PI16 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PI16 from Human, Mouse. This PI16 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PI16 protein

Human Peptidase Inhibitor 16 (PI16) ELISA Kit

DLR-PI16-Hu-48T 48T
EUR 554
  • Should the Human Peptidase Inhibitor 16 (PI16) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Peptidase Inhibitor 16 (PI16) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Peptidase Inhibitor 16 (PI16) ELISA Kit

DLR-PI16-Hu-96T 96T
EUR 725
  • Should the Human Peptidase Inhibitor 16 (PI16) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Peptidase Inhibitor 16 (PI16) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Peptidase Inhibitor 16 (PI16) ELISA Kit

RD-PI16-Hu-48Tests 48 Tests
EUR 563

Human Peptidase Inhibitor 16 (PI16) ELISA Kit

RD-PI16-Hu-96Tests 96 Tests
EUR 783

Human Peptidase Inhibitor 16 (PI16) ELISA Kit

RDR-PI16-Hu-48Tests 48 Tests
EUR 589

Human Peptidase Inhibitor 16 (PI16) ELISA Kit

RDR-PI16-Hu-96Tests 96 Tests
EUR 820

PI16 antibody

70R-6245 50 ug
EUR 467
Description: Rabbit polyclonal PI16 antibody raised against the middle region of PI16

PI16 antibody

70R-19271 50 ul
EUR 435
Description: Rabbit polyclonal PI16 antibody

PI16 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PI16. Recognizes PI16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti- PI16 antibody

FNab06415 100µg
EUR 585
  • Immunogen: peptidase inhibitor 16
  • Uniprot ID: Q6UXB8
  • Gene ID: 221476
  • Research Area: Immunology, Metabolism
Description: Antibody raised against PI16

Anti-PI16 antibody

PAab06415 100 ug
EUR 412

Anti-PI16 antibody

STJ192137 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PI16

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Bovine)

  • EUR 293.00
  • EUR 3249.00
  • EUR 793.00
  • EUR 377.00
  • EUR 234.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu28~Pro442)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Peptidase Inhibitor 16 (PI16)

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Human)

  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu28~Gly440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase Inhibitor 16 (PI16)

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Mouse)

  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu21~Lys468)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Peptidase Inhibitor 16 (PI16)

PI16 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PI16 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Bovine), APC

  • EUR 415.00
  • EUR 4283.00
  • EUR 1164.00
  • EUR 540.00
  • EUR 250.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu28~Pro442)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Peptidase Inhibitor 16 (PI16). This antibody is labeled with APC.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Bovine), Biotinylated

  • EUR 363.00
  • EUR 3199.00
  • EUR 912.00
  • EUR 454.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu28~Pro442)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Peptidase Inhibitor 16 (PI16). This antibody is labeled with Biotin.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Bovine), Cy3

  • EUR 512.00
  • EUR 5669.00
  • EUR 1511.00
  • EUR 679.00
  • EUR 291.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu28~Pro442)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Peptidase Inhibitor 16 (PI16). This antibody is labeled with Cy3.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Bovine), FITC

  • EUR 352.00
  • EUR 3446.00
  • EUR 951.00
  • EUR 452.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu28~Pro442)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Peptidase Inhibitor 16 (PI16). This antibody is labeled with FITC.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Bovine), HRP

  • EUR 376.00
  • EUR 3728.00
  • EUR 1025.00
  • EUR 485.00
  • EUR 233.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu28~Pro442)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Peptidase Inhibitor 16 (PI16). This antibody is labeled with HRP.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Bovine), PE

  • EUR 352.00
  • EUR 3446.00
  • EUR 951.00
  • EUR 452.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu28~Pro442)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Peptidase Inhibitor 16 (PI16). This antibody is labeled with PE.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Human), APC

  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu28~Gly440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase Inhibitor 16 (PI16). This antibody is labeled with APC.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Human), Biotinylated

  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu28~Gly440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase Inhibitor 16 (PI16). This antibody is labeled with Biotin.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Human), Cy3

  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu28~Gly440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase Inhibitor 16 (PI16). This antibody is labeled with Cy3.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Human), FITC

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu28~Gly440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase Inhibitor 16 (PI16). This antibody is labeled with FITC.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Human), HRP

  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu28~Gly440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase Inhibitor 16 (PI16). This antibody is labeled with HRP.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Human), PE

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu28~Gly440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase Inhibitor 16 (PI16). This antibody is labeled with PE.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Mouse), APC

  • EUR 374.00
  • EUR 3689.00
  • EUR 1016.00
  • EUR 481.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu21~Lys468)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Peptidase Inhibitor 16 (PI16). This antibody is labeled with APC.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 332.00
  • EUR 2763.00
  • EUR 803.00
  • EUR 411.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu21~Lys468)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Peptidase Inhibitor 16 (PI16). This antibody is labeled with Biotin.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Mouse), Cy3

  • EUR 457.00
  • EUR 4877.00
  • EUR 1313.00
  • EUR 600.00
  • EUR 267.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu21~Lys468)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Peptidase Inhibitor 16 (PI16). This antibody is labeled with Cy3.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Mouse), FITC

  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu21~Lys468)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Peptidase Inhibitor 16 (PI16). This antibody is labeled with FITC.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Mouse), HRP

  • EUR 341.00
  • EUR 3213.00
  • EUR 897.00
  • EUR 433.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu21~Lys468)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Peptidase Inhibitor 16 (PI16). This antibody is labeled with HRP.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Mouse), PE

  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu21~Lys468)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Peptidase Inhibitor 16 (PI16). This antibody is labeled with PE.

PI16 cloning plasmid

CSB-CL017951HU1-10ug 10ug
EUR 469
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1287
  • Sequence: atggtggagctgcacaacctctaccgggcccaggtatccccgccggcctcagacatgctgcacatgagatgggacgaggagctggccgccttcgccaaggcctacgcacggcagtgcgtgtggggccacaacaaggagcgcgggcgccgcggcgagaatctgttcgccatcacag
  • Show more
Description: A cloning plasmid for the PI16 gene.

PI16 cloning plasmid

CSB-CL017951HU2-10ug 10ug
EUR 453
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1227
  • Sequence: atgcacggctcctgcagtttcctgatgcttctgctgccgctactgctactgctggtggccaccacaggccccgttggagccctcacagatgaggagaaacgtttgatggtggagctgcacaacctctaccgggcccaggtatccccgacggcctcagacatgctgcacatgagat
  • Show more
Description: A cloning plasmid for the PI16 gene.

PI16 Blocking Peptide

33R-8568 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PI16 antibody, catalog no. 70R-6245

Peptidase Inhibitor 16 (PI16) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Peptidase Inhibitor 16 (PI16) Antibody

  • EUR 328.00
  • EUR 133.00
  • EUR 899.00
  • EUR 467.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Peptidase Inhibitor 16 (PI16) Antibody

  • EUR 509.00
  • EUR 133.00
  • EUR 1539.00
  • EUR 718.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Peptidase Inhibitor 16 (PI16) Antibody

abx029735-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Peptidase Inhibitor 16 (PI16) Antibody

abx029735-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Peptidase Inhibitor 16 (PI16) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Peptidase Inhibitor 16 (PI16) Antibody

  • EUR 523.00
  • EUR 606.00
  • EUR 300.00
  • EUR 940.00
  • EUR 384.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-12 working days.

Peptidase Inhibitor 16 (PI16) Antibody

abx236415-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Bovine), APC-Cy7

  • EUR 711.00
  • EUR 8446.00
  • EUR 2209.00
  • EUR 961.00
  • EUR 380.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu28~Pro442)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Peptidase Inhibitor 16 (PI16). This antibody is labeled with APC-Cy7.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Human), APC-Cy7

  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu28~Gly440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase Inhibitor 16 (PI16). This antibody is labeled with APC-Cy7.

Peptidase Inhibitor 16 (PI16) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 628.00
  • EUR 7258.00
  • EUR 1912.00
  • EUR 842.00
  • EUR 344.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PI16 (Leu21~Lys468)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Peptidase Inhibitor 16 (PI16). This antibody is labeled with APC-Cy7.

Peptidase Inhibitor 16 (PI16) Antibody (FITC)

  • EUR 592.00
  • EUR 704.00
  • EUR 328.00
  • EUR 1107.00
  • EUR 439.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Peptidase Inhibitor 16 (PI16) Antibody (APC)

  • EUR 815.00
  • EUR 968.00
  • EUR 411.00
  • EUR 1567.00
  • EUR 565.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Peptidase Inhibitor 16 (PI16) Antibody (PE)

  • EUR 704.00
  • EUR 829.00
  • EUR 370.00
  • EUR 1330.00
  • EUR 495.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Peptidase Inhibitor 16 (PI16) Antibody (Biotin)

  • EUR 481.00
  • EUR 244.00
  • EUR 1428.00
  • EUR 676.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Peptidase Inhibitor 16 (PI16) Antibody (Biotin)

  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse PI16 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF001756 96 Tests
EUR 689

Human PI16 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PI16 Recombinant Protein (Human)

RP023398 100 ug Ask for price

PI16 Recombinant Protein (Human)

RP023401 100 ug Ask for price

PI16 Recombinant Protein (Rat)

RP220421 100 ug Ask for price

PI16 Recombinant Protein (Mouse)

RP161930 100 ug Ask for price

PI16 Rabbit Polyclonal Antibody