KLK15 Rabbit Polyclonal Antibody
KLK15 Rabbit Polyclonal Antibody
To Order Now: info@crossfiredatabases.com
KLK15 Polyclonal Antibody |
ES11229-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against KLK15 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
KLK15 Rabbit pAb |
A2757-100ul |
Abclonal |
100 ul |
EUR 308 |
KLK15 Rabbit pAb |
A2757-200ul |
Abclonal |
200 ul |
EUR 459 |
KLK15 Rabbit pAb |
A2757-20ul |
Abclonal |
20 ul |
EUR 183 |
KLK15 Rabbit pAb |
A2757-50ul |
Abclonal |
50 ul |
EUR 223 |
KLK15 Antibody |
35797-100ul |
SAB |
100ul |
EUR 252 |
KLK15 Antibody |
1-CSB-PA124101 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against KLK15. Recognizes KLK15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000 |
KLK15 Antibody |
1-CSB-PA039843 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against KLK15. Recognizes KLK15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100 |
KLK15 antibody |
70R-KR010 |
Fitzgerald |
100 ug |
EUR 300 |
Description: Affinity purified Rabbit polyclonal KLK15 antibody |
Kallikrein 15 (KLK15) polyclonal antibody |
ABP-PAB-10212 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
KLK15 Conjugated Antibody |
C35797 |
SAB |
100ul |
EUR 397 |
Anti-KLK15 antibody |
STJ24330 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. In prostate cancer, this gene has increased expression, which indicates its possible use as a diagnostic or prognostic marker for prostate cancer. The gene contains multiple polyadenylation sites and alternative splicing results in multiple transcript variants encoding distinct isoforms. |
Anti-KLK15 antibody |
STJ192387 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to KLK15 |
KLK15 siRNA |
20-abx921822 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KLK15 cloning plasmid |
CSB-CL884452HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 768
- Sequence: atgtggcttctcctcactctctccttcctgctggcatccacagcccaggatggtgacaagttgctggaaggtgacgagtgtgcaccccactcccagccatggcaagtggctctctacgagcgtggacgctttaactgtggcgcttccctcatctccccacactgggtgctgtctgc
- Show more
|
Description: A cloning plasmid for the KLK15 gene. |
KLK15 cloning plasmid |
CSB-CL884452HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 771
- Sequence: atgtggcttctcctcactctctccttcctgctggcatccacagcagcccaggatggtgacaagttgctggaaggtgacgagtgtgcaccccactcccagccatggcaagtggctctctacgagcgtggacgctttaactgtggcgcttccctcatctccccacactgggtgctgtc
- Show more
|
Description: A cloning plasmid for the KLK15 gene. |
KLK15 cloning plasmid |
CSB-CL884452HU3-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 771
- Sequence: atgtggcttctcctcactctctccttcctgctggcatccacagcagcccaggatggtgacaagttgctggaaggtgacgagtgtgcaccccactcccagccatggcaagtggctctctacgagcgtggacgctttaactgtggcgcttccctcatctccccacactgggtgctgtc
- Show more
|
Description: A cloning plasmid for the KLK15 gene. |
Human Kallikrein-15 (KLK15) Antibody |
35623-05111 |
AssayPro |
150 ug |
EUR 261 |
KLK15 protein (His tag) |
80R-3691 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified recombinant KLK15 protein (His tag) |
Human KLK15 shRNA Plasmid |
20-abx960736 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
KLK15 Recombinant Protein (Human) |
RP017233 |
ABM |
100 ug |
Ask for price |
KLK15 Recombinant Protein (Human) |
RP017236 |
ABM |
100 ug |
Ask for price |
KLK15 Recombinant Protein (Human) |
RP040465 |
ABM |
100 ug |
Ask for price |
KLK15 Recombinant Protein (Mouse) |
RP146096 |
ABM |
100 ug |
Ask for price |
Kallikrein Related Peptidase 15 (KLK15) Antibody |
20-abx006178 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Kallikrein Related Peptidase 15 (KLK15) Antibody |
20-abx211072 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Kallikrein Related Peptidase 15 (KLK15) Antibody |
20-abx212314 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Kallikrein Related Peptidase 15 (KLK15) Antibody |
abx028332-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Kallikrein Related Peptidase 15 (KLK15) Antibody |
abx028332-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Human Kallikrein-15 (KLK15) Antibody (Biotin Conjugate) |
35623-05121 |
AssayPro |
150 ug |
EUR 369 |
KLK15 ORF Vector (Human) (pORF) |
ORF005745 |
ABM |
1.0 ug DNA |
EUR 95 |
KLK15 ORF Vector (Human) (pORF) |
ORF005746 |
ABM |
1.0 ug DNA |
EUR 95 |
KLK15 ORF Vector (Human) (pORF) |
ORF013489 |
ABM |
1.0 ug DNA |
EUR 354 |
Klk15 ORF Vector (Mouse) (pORF) |
ORF048700 |
ABM |
1.0 ug DNA |
EUR 506 |
Human Kallikrein-15 (KLK15) AssayLite Antibody (FITC Conjugate) |
35623-05141 |
AssayPro |
150 ug |
EUR 428 |
Human Kallikrein-15 (KLK15) AssayLite Antibody (RPE Conjugate) |
35623-05151 |
AssayPro |
150 ug |
EUR 428 |
Human Kallikrein-15 (KLK15) AssayLite Antibody (APC Conjugate) |
35623-05161 |
AssayPro |
150 ug |
EUR 428 |
Human Kallikrein-15 (KLK15) AssayLite Antibody (PerCP Conjugate) |
35623-05171 |
AssayPro |
150 ug |
EUR 471 |
Klk15 sgRNA CRISPR Lentivector set (Mouse) |
K4285101 |
ABM |
3 x 1.0 ug |
EUR 339 |
KLK15 sgRNA CRISPR Lentivector set (Human) |
K1160901 |
ABM |
3 x 1.0 ug |
EUR 339 |
KLK15 Kallikrein-15 Human Recombinant Protein |
PROTQ9H2R5 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: KLK15 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 258 amino acids (22-256a.a) and having a molecular mass of 28.2kDa. ;KLK15 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Klk15 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4285102 |
ABM |
1.0 ug DNA |
EUR 154 |
Klk15 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4285103 |
ABM |
1.0 ug DNA |
EUR 154 |
Klk15 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4285104 |
ABM |
1.0 ug DNA |
EUR 154 |
KLK15 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1160902 |
ABM |
1.0 ug DNA |
EUR 154 |
KLK15 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1160903 |
ABM |
1.0 ug DNA |
EUR 154 |
KLK15 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1160904 |
ABM |
1.0 ug DNA |
EUR 154 |
KLK15 Protein Vector (Human) (pPB-C-His) |
PV022977 |
ABM |
500 ng |
EUR 329 |
KLK15 Protein Vector (Human) (pPB-N-His) |
PV022978 |
ABM |
500 ng |
EUR 329 |
KLK15 Protein Vector (Human) (pPM-C-HA) |
PV022979 |
ABM |
500 ng |
EUR 329 |
KLK15 Protein Vector (Human) (pPM-C-His) |
PV022980 |
ABM |
500 ng |
EUR 329 |
KLK15 Protein Vector (Human) (pPB-C-His) |
PV022981 |
ABM |
500 ng |
EUR 329 |
KLK15 Protein Vector (Human) (pPB-N-His) |
PV022982 |
ABM |
500 ng |
EUR 329 |
KLK15 Protein Vector (Human) (pPM-C-HA) |
PV022983 |
ABM |
500 ng |
EUR 329 |
KLK15 Protein Vector (Human) (pPM-C-His) |
PV022984 |
ABM |
500 ng |
EUR 329 |
KLK15 Protein Vector (Mouse) (pPB-C-His) |
PV194798 |
ABM |
500 ng |
EUR 603 |
KLK15 Protein Vector (Mouse) (pPB-N-His) |
PV194799 |
ABM |
500 ng |
EUR 603 |
KLK15 Protein Vector (Mouse) (pPM-C-HA) |
PV194800 |
ABM |
500 ng |
EUR 603 |
KLK15 Protein Vector (Mouse) (pPM-C-His) |
PV194801 |
ABM |
500 ng |
EUR 603 |
KLK15 Protein Vector (Human) (pPB-C-His) |
PV053953 |
ABM |
500 ng |
EUR 481 |
KLK15 Protein Vector (Human) (pPB-N-His) |
PV053954 |
ABM |
500 ng |
EUR 481 |
KLK15 Protein Vector (Human) (pPM-C-HA) |
PV053955 |
ABM |
500 ng |
EUR 481 |
KLK15 Protein Vector (Human) (pPM-C-His) |
PV053956 |
ABM |
500 ng |
EUR 481 |
Recombinant Human KLK15 Protein, His, E.coli-1mg |
QP12504-HIS-1mg |
EnQuireBio |
1mg |
EUR 2757 |
Recombinant Human KLK15 Protein, His, E.coli-1ug |
QP12504-HIS-1ug |
EnQuireBio |
1ug |
EUR 155 |
Recombinant Human KLK15 Protein, His, E.coli-20ug |
QP12504-HIS-20ug |
EnQuireBio |
20ug |
EUR 201 |
Recombinant Human KLK15 Protein, His, E.coli-50ug |
QP12504-HIS-50ug |
EnQuireBio |
50ug |
EUR 1261 |
Recombinant Human KLK15 Protein, His, E.coli-5ug |
QP12504-HIS-EC-5ug |
EnQuireBio |
5ug |
EUR 155 |
Recombinant Human KLK15 Protein, His, Insect-5ug |
QP12504-HIS-INSECT-5ug |
EnQuireBio |
5ug |
EUR 201 |
Klk15 3'UTR Luciferase Stable Cell Line |
TU110668 |
ABM |
1.0 ml |
Ask for price |
Klk15 3'UTR GFP Stable Cell Line |
TU160668 |
ABM |
1.0 ml |
Ask for price |
Klk15 3'UTR Luciferase Stable Cell Line |
TU206790 |
ABM |
1.0 ml |
Ask for price |
Klk15 3'UTR GFP Stable Cell Line |
TU256790 |
ABM |
1.0 ml |
Ask for price |
KLK15 3'UTR GFP Stable Cell Line |
TU061901 |
ABM |
1.0 ml |
EUR 1394 |
KLK15 Rabbit Polyclonal Antibody