TBX20 Rabbit Polyclonal Antibody

TBX20 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

TBX20 Polyclonal Antibody

ABP60635-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TBX20 protein at amino acid sequence of 211-260
  • Applications tips:
Description: A polyclonal antibody for detection of TBX20 from Human, Mouse. This TBX20 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBX20 protein at amino acid sequence of 211-260

TBX20 Polyclonal Antibody

ES11408-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TBX20 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TBX20 Polyclonal Antibody

ES11408-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TBX20 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TBX20 Rabbit pAb

A15994-100ul 100 ul
EUR 308

TBX20 Rabbit pAb

A15994-200ul 200 ul
EUR 459

TBX20 Rabbit pAb

A15994-20ul 20 ul
EUR 183

TBX20 Rabbit pAb

A15994-50ul 50 ul
EUR 223

TBX20 Antibody

35742-100ul 100ul
EUR 252

TBX20 Antibody

1-CSB-PA234177
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TBX20. Recognizes TBX20 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

Rabbit T box transcription factor TBX20(TBX20) ELISA kit

E04T0666-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit T box transcription factor TBX20(TBX20) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit T box transcription factor TBX20(TBX20) ELISA kit

E04T0666-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit T box transcription factor TBX20(TBX20) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit T box transcription factor TBX20(TBX20) ELISA kit

E04T0666-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit T box transcription factor TBX20(TBX20) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

T-box 20 (TBX20) polyclonal antibody

ABP-PAB-11248 100 ug Ask for price
    • Product line: Transcription Factors
    • Brand:

TBX20 Conjugated Antibody

C35742 100ul
EUR 397

Anti-TBX20 antibody

STJ118453 100 µl
EUR 277

Anti-TBX20 antibody

STJ192566 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TBX20

TBX20 siRNA

20-abx936262
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TBX20 siRNA

20-abx936263
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-Tbx20

YF-PA20110 50 ug
EUR 363
Description: Mouse polyclonal to Tbx20

TBX20 cloning plasmid

CSB-CL892476HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 894
  • Sequence: ATGGAGTTCACGGCGTCCCCCAAGCCCCAACTCTCCTCCCGGGCCAACGCCTTCTCCATTGCCGCGCTCATGTCGAGCGGCGGCTCTAAGGAGAAGGAGGCGACGGAGAACACAATCAAACCCCTGGAGCAATTTGTGGAGAAGTCGTCCTGTGCCCAGCCCCTGGGTGAGCTGAC
  • Show more
Description: A cloning plasmid for the TBX20 gene.

T-Box 20 (TBX20) Antibody

20-abx213504
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rat T box transcription factor TBX20(TBX20) ELISA kit

E02T0666-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat T box transcription factor TBX20(TBX20) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat T box transcription factor TBX20(TBX20) ELISA kit

E02T0666-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat T box transcription factor TBX20(TBX20) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TBX20 Rabbit Polyclonal Antibody