PZP Rabbit Polyclonal Antibody

PZP Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

PZP Polyclonal Antibody
ES11393-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PZP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
PZP Polyclonal Antibody
ABP60051-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PZP protein at amino acid sequence of 1301-1350
  • Applications tips:
Description: A polyclonal antibody for detection of PZP from Human. This PZP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PZP protein at amino acid sequence of 1301-1350
PZP Polyclonal Antibody
ABP60051-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PZP protein at amino acid sequence of 1301-1350
  • Applications tips:
Description: A polyclonal antibody for detection of PZP from Human. This PZP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PZP protein at amino acid sequence of 1301-1350
PZP Polyclonal Antibody
ABP60051-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PZP protein at amino acid sequence of 1301-1350
  • Applications tips:
Description: A polyclonal antibody for detection of PZP from Human. This PZP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PZP protein at amino acid sequence of 1301-1350
PZP Polyclonal Antibody
A53244 100 µg
EUR 570.55
Description: fast delivery possible
PZP Polyclonal Antibody
30444-100ul 100ul
EUR 252
PZP Polyclonal Antibody
30444-50ul 50ul
EUR 187
Human Pregnancy Zone Protein (PZP) ELISA Kit
DLR-PZP-Hu-48T 48T
EUR 517
  • Should the Human Pregnancy Zone Protein (PZP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Pregnancy Zone Protein (PZP) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Pregnancy Zone Protein (PZP) ELISA Kit
DLR-PZP-Hu-96T 96T
EUR 673
  • Should the Human Pregnancy Zone Protein (PZP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Pregnancy Zone Protein (PZP) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Pregnancy Zone Protein (PZP) ELISA Kit
RD-PZP-Hu-48Tests 48 Tests
EUR 521
Human Pregnancy Zone Protein (PZP) ELISA Kit
RD-PZP-Hu-96Tests 96 Tests
EUR 723
Human Pregnancy Zone Protein (PZP) ELISA Kit
RDR-PZP-Hu-48Tests 48 Tests
EUR 544
Human Pregnancy Zone Protein (PZP) ELISA Kit
RDR-PZP-Hu-96Tests 96 Tests
EUR 756
PZP Rabbit pAb
A3324-100ul 100 ul
EUR 308
PZP Rabbit pAb
A3324-200ul 200 ul
EUR 459
PZP Rabbit pAb
A3324-20ul 20 ul
EUR 183
PZP Rabbit pAb
A3324-50ul 50 ul
EUR 223
PZP Polyclonal Conjugated Antibody
C30444 100ul
EUR 397
PZP antibody
70R-19675 50 ul
EUR 435
Description: Rabbit polyclonal PZP antibody
PZP Antibody
1-CSB-PA019131GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PZP. Recognizes PZP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB
PZP Antibody
1-CSB-PA019131HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PZP. Recognizes PZP from Human. This antibody is Unconjugated. Tested in the following application: ELISA
PZP Polyclonal Antibody, Biotin Conjugated
A53241 100 µg
EUR 570.55
Description: kits suitable for this type of research
PZP Polyclonal Antibody, FITC Conjugated
A53242 100 µg
EUR 570.55
Description: fast delivery possible
PZP Polyclonal Antibody, HRP Conjugated
A53243 100 µg
EUR 570.55
Description: reagents widely cited
Anti-PZP antibody
STJ116200 100 µl
EUR 277
Description: The protein encoded by this gene is highly expressed in late-pregnancy serum and is similar in structure to alpha-2-macroglobulin. The encoded protein, which acts as a homotetramer, inhibits the activity of all four classes of proteinases. This protein contains cleavage sites for several proteinases. Upon binding of a proteinase, the conformation of this protein changes to trap the proteinase, limiting its activity. This protein appears to be elevated in the sera of presymptomatic Alzheimer's disease patients.
Anti-PZP antibody
STJ192551 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PZP
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human)
4-PAG324Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Val1212~Met1391)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP)
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse)
4-PAG324Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Tyr1224~Ala1495)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP)
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse)
4-PAG324Mu02
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1246~Ala1495)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP)
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat)
4-PAG324Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1251~Ala1500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP)
PZP Antibody, HRP conjugated
1-CSB-PA019131HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PZP. Recognizes PZP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PZP Antibody, FITC conjugated
1-CSB-PA019131HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PZP. Recognizes PZP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PZP Antibody, Biotin conjugated
1-CSB-PA019131HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PZP. Recognizes PZP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), APC
4-PAG324Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Val1212~Met1391)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with APC.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), Biotinylated
4-PAG324Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Val1212~Met1391)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with Biotin.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), Cy3
4-PAG324Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Val1212~Met1391)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with Cy3.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), FITC
4-PAG324Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Val1212~Met1391)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with FITC.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), HRP
4-PAG324Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Val1212~Met1391)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with HRP.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), PE
4-PAG324Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Val1212~Met1391)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with PE.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), APC
4-PAG324Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Tyr1224~Ala1495)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with APC.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), Biotinylated
4-PAG324Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Tyr1224~Ala1495)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with Biotin.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), Cy3
4-PAG324Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Tyr1224~Ala1495)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with Cy3.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), FITC
4-PAG324Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Tyr1224~Ala1495)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with FITC.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), HRP
4-PAG324Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Tyr1224~Ala1495)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with HRP.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), PE
4-PAG324Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Tyr1224~Ala1495)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with PE.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), APC
4-PAG324Mu02-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1246~Ala1495)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with APC.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), Biotinylated
4-PAG324Mu02-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1246~Ala1495)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with Biotin.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), Cy3
4-PAG324Mu02-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1246~Ala1495)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with Cy3.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), FITC
4-PAG324Mu02-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1246~Ala1495)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with FITC.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), HRP
4-PAG324Mu02-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1246~Ala1495)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with HRP.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), PE
4-PAG324Mu02-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1246~Ala1495)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with PE.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), APC
4-PAG324Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1251~Ala1500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with APC.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), Biotinylated
4-PAG324Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1251~Ala1500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with Biotin.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), Cy3
4-PAG324Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1251~Ala1500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with Cy3.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), FITC
4-PAG324Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1251~Ala1500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with FITC.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), HRP
4-PAG324Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1251~Ala1500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with HRP.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), PE
4-PAG324Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1251~Ala1500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with PE.
PZP cloning plasmid
CSB-CL019131HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3807
  • Sequence: ATGTCTGAATCTTATCGGAGAACTACTTTTCCAGTAAGATTCCGTGTTGTCTCCGTGGATGAAAATTTTCGCCCTCGAAATGAACTGATTCCACTGATATACCTTGAGAACCCAAGAAGAAATCGAATTGCACAATGGCAGAGTCTCAAGCTAGAAGCTGGCATCAATCAGTTGT
  • Show more
Description: A cloning plasmid for the PZP gene.
Pregnancy Zone Protein (PZP) Antibody
20-abx129879
  • EUR 314.00
  • EUR 133.00
  • EUR 829.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Pregnancy Zone Protein (PZP) Antibody
20-abx002369
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Pregnancy Zone Protein (PZP) Antibody
20-abx102180
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Pregnancy Zone Protein (PZP) Antibody
20-abx102181
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Pregnancy Zone Protein (PZP) Antibody
20-abx102182
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Pregnancy Zone Protein (PZP) Antibody
20-abx174149
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), APC-Cy7
4-PAG324Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Val1212~Met1391)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with APC-Cy7.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), APC-Cy7
4-PAG324Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Tyr1224~Ala1495)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with APC-Cy7.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), APC-Cy7
4-PAG324Mu02-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1246~Ala1495)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with APC-Cy7.
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), APC-Cy7
4-PAG324Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1251~Ala1500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with APC-Cy7.
Pregnancy Zone Protein (PZP) Antibody (HRP)
20-abx274625
  • EUR 509.00
  • EUR 258.00
  • EUR 1525.00
  • EUR 704.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Pregnancy Zone Protein (PZP) Antibody Pair
20-abx370759
  • EUR 1859.00
  • EUR 1177.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.
Pregnancy Zone Protein (PZP) Antibody Pair
20-abx370771
  • EUR 1776.00
  • EUR 1135.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.
Pregnancy Zone Protein (PZP) Antibody (FITC)
20-abx271207
  • EUR 509.00
  • EUR 258.00
  • EUR 1525.00
  • EUR 704.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Pregnancy Zone Protein (PZP) Antibody (FITC)
20-abx271260
  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 676.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Pregnancy Zone Protein (PZP) Antibody (Biotin)
20-abx271473
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Pregnancy Zone Protein (PZP) Antibody (Biotin)
20-abx271526
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Pregnancy Zone Protein (PZP) Antibody (Biotin)
20-abx272390
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human PZP ELISA Kit
ELA-E1140h 96 Tests
EUR 824
PZP ELISA KIT|Human
EF003623 96 Tests
EUR 689
Human PZP PicoKine ELISA Kit
EK1873 96 wells
EUR 425
Description: For quantitative detection of human PZP in cell culture supernates, serum and plasma (heparin, EDTA).
Human Pregnancy zone protein (PZP)
1-CSB-YP019131HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 65.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Pregnancy zone protein(PZP),partial expressed in Yeast
Human Pregnancy zone protein (PZP)
1-CSB-EP019131HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 42.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Pregnancy zone protein(PZP),partial expressed in E.coli
Pzp ORF Vector (Rat) (pORF)
ORF074390 1.0 ug DNA
EUR 2080
PZP ORF Vector (Human) (pORF)
ORF014217 1.0 ug DNA
EUR 354
Pzp ORF Vector (Mouse) (pORF)
ORF055356 1.0 ug DNA
EUR 1572
Recombinant Pregnancy Zone Protein (PZP)
4-RPG324Hu01
  • EUR 583.84
  • EUR 259.00
  • EUR 1914.40
  • EUR 704.80
  • EUR 1309.60
  • EUR 454.00
  • EUR 4636.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P20742
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.1kDa
  • Isoelectric Point: 6.3
Description: Recombinant Human Pregnancy Zone Protein expressed in: E.coli
Recombinant Pregnancy Zone Protein (PZP)
4-RPG324Mu01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q61838
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 56.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Pregnancy Zone Protein expressed in: E.coli
Recombinant Pregnancy Zone Protein (PZP)
4-RPG324Mu02
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q61838
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Pregnancy Zone Protein expressed in: E.coli
Recombinant Pregnancy Zone Protein (PZP)
4-RPG324Ra01
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q63041
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 53.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Pregnancy Zone Protein expressed in: E.coli
PZP ELISA Kit (Mouse) (OKAN04986)
OKAN04986 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.65 ng/mL
PZP ELISA Kit (Human) (OKAN06584)
OKAN06584 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.118 ng/mL
PZP ELISA Kit (Human) (OKBB01285)
OKBB01285 96 Wells
EUR 505
Description: Description of target: Pregnancy zone protein (PZP) is a protein which in humans is encoded by the PZP gene on chromosome 12. It is mapped to 12p13.31. The protein encoded by this gene is highly expressed in late-pregnancy serum and is similar in structure to alpha-2-macroglobulin. The encoded protein, which acts as a homotetramer, inhibits the activity of all four classes of proteinases. This protein contains cleavage sites for several proteinases. Upon binding of a proteinase, the conformation of this protein changes to trap the proteinase, limiting its activity. This protein appears to be elevated in the sera of presymptomatic Alzheimer's disease patients.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml
PZP ELISA Kit (Human) (OKCD08911)
OKCD08911 96 Wells
EUR 975
Description: Description of target: Rabbit anti-human Pregnancy zone polyclonal Antibody;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.118ng/mL
PZP ELISA Kit (Mouse) (OKCD08912)
OKCD08912 96 Wells
EUR 1001
Description: Description of target: Is able to inhibit all four classes of proteinases by a unique 'trapping' mechanism. This protein has a peptide stretch, called the 'bait region' which contains specific cleavage sites for different proteinases. When a proteinase cleaves the bait region, a conformational change is induced in the protein which traps the proteinase. The entrapped enzyme remains active against low molecular weight substrates (activity against high molecular weight substrates is greatly reduced). Following cleavage in the bait region, a thioester bond is hydrolyzed and mediates the covalent binding of the protein to the proteinase. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.64ng/mL
PZP ELISA Kit (Rat) (OKCD08913)
OKCD08913 96 Wells
EUR 1053
Description: Description of target: plasma protease inhibitor.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 2.7ng/mL
PZP ELISA Kit (Human) (OKEH04635)
OKEH04635 96 Wells
EUR 662
Description: Description of target: Is able to inhibit all four classes of proteinases by a unique 'trapping' mechanism. This protein has a peptide stretch, called the 'bait region' which contains specific cleavage sites for different proteinases. When a proteinase cleaves the bait region, a conformational change is induced in the protein which traps the proteinase. The entrapped enzyme remains active against low molecular weight substrates (activity against high molecular weight substrates is greatly reduced). Following cleavage in the bait region a thioester bond is hydrolyzed and mediates the covalent binding of the protein to the proteinase.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 43 pg/mL
Human Pregnancy Zone Protein (PZP) Protein
20-abx068659
  • EUR 815.00
  • EUR 314.00
  • EUR 2569.00
  • EUR 968.00
  • EUR 565.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Rat Pregnancy Zone Protein (PZP) Protein
20-abx068660
  • EUR 759.00
  • EUR 300.00
  • EUR 2388.00
  • EUR 913.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Mouse Pregnancy Zone Protein (PZP) Protein
20-abx068661
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Mouse Pregnancy Zone Protein (PZP) Protein
20-abx165942
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
PZP sgRNA CRISPR Lentivector set (Human)
K1765801 3 x 1.0 ug
EUR 339
Pzp sgRNA CRISPR Lentivector set (Mouse)
K3715701 3 x 1.0 ug
EUR 339
Pzp sgRNA CRISPR Lentivector set (Rat)
K7332401 3 x 1.0 ug
EUR 339
Mouse Pregnancy Zone Protein (PZP) CLIA Kit
20-abx496457
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Rat Pregnancy Zone Protein (PZP) CLIA Kit
20-abx496528
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Pregnancy zone protein (PZP) ELISA Kit
abx576051-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human PZP/ Pregnancy zone protein ELISA Kit
E2110Hu 1 Kit
EUR 571
Human PZP(Pregnancy zone protein) ELISA Kit
EH1299 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: P20742
  • Alias: PZP/CPAMD6(Pregnancy zone protein)/C3 and PZP-like alpha-2-macroglobulin domain-containing protein 6/pregnancy-zone protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml
Human Pregnancy zone protein, PZP ELISA KIT
ELI-03752h 96 Tests
EUR 824
Human Pregnancy Zone Protein (PZP) ELISA Kit
20-abx152906
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Pregnancy Zone Protein (PZP) ELISA Kit
20-abx258971
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Rat Pregnancy Zone Protein (PZP) ELISA Kit
20-abx258972
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Pregnancy Zone Protein (PZP) CLIA Kit
20-abx495159
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
PZP sgRNA CRISPR Lentivector (Human) (Target 1)
K1765802 1.0 ug DNA
EUR 154
PZP sgRNA CRISPR Lentivector (Human) (Target 2)
K1765803 1.0 ug DNA
EUR 154
PZP sgRNA CRISPR Lentivector (Human) (Target 3)
K1765804 1.0 ug DNA
EUR 154
Pzp sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3715702 1.0 ug DNA
EUR 154
Pzp sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3715703 1.0 ug DNA
EUR 154
Pzp sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3715704 1.0 ug DNA
EUR 154
Human Pregnancy zone protein(PZP) ELISA kit
CSB-EL019131HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Human Pregnancy zone protein (PZP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Pregnancy zone protein(PZP) ELISA kit
1-CSB-EL019131HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Human Pregnancy zone protein(PZP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Pzp sgRNA CRISPR Lentivector (Rat) (Target 1)
K7332402 1.0 ug DNA
EUR 154
Pzp sgRNA CRISPR Lentivector (Rat) (Target 2)
K7332403 1.0 ug DNA
EUR 154
Pzp sgRNA CRISPR Lentivector (Rat) (Target 3)
K7332404 1.0 ug DNA
EUR 154
PZP Protein Vector (Human) (pPB-C-His)
PV056865 500 ng
EUR 481
PZP Protein Vector (Human) (pPB-N-His)
PV056866 500 ng
EUR 481
PZP Protein Vector (Human) (pPM-C-HA)
PV056867 500 ng
EUR 481
PZP Protein Vector (Human) (pPM-C-His)
PV056868 500 ng
EUR 481
Human Pregnancy Zone Protein ELISA Kit (PZP)
RK02175 96 Tests
EUR 521
Mouse Pregnancy Zone Protein ELISA Kit (PZP)
RK03150 96 Tests
EUR 521
Human Pregnancy Zone Protein(PZP)ELISA Kit
QY-E01765 96T
EUR 361
PZP Protein Vector (Rat) (pPB-C-His)
PV297558 500 ng
EUR 2538
PZP Protein Vector (Rat) (pPB-N-His)
PV297559 500 ng
EUR 2538
PZP Protein Vector (Rat) (pPM-C-HA)
PV297560 500 ng
EUR 2538
PZP Protein Vector (Rat) (pPM-C-His)
PV297561 500 ng
EUR 2538
PZP Protein Vector (Mouse) (pPB-C-His)
PV221422 500 ng
EUR 2530
PZP Protein Vector (Mouse) (pPB-N-His)
PV221423 500 ng
EUR 2530
PZP Protein Vector (Mouse) (pPM-C-HA)
PV221424 500 ng
EUR 2530
PZP Protein Vector (Mouse) (pPM-C-His)
PV221425 500 ng
EUR 2530
Pzp 3'UTR GFP Stable Cell Line
TU167359 1.0 ml Ask for price
Human Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids.
Human Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids.
Human Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids.
Human Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids.
Human Pregnancy Zone Protein (PZP) ELISA Kit
4-SEG324Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Pregnancy Zone Protein elisa. Alternative names of the recognized antigen: CPAMD6
  • C3 and PZP-like alpha-2-macroglobulin domain-containing protein 6
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Pregnancy Zone Protein (PZP) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Mouse Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Pregnancy Zone Protein (PZP) ELISA Kit
4-SEG324Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Pregnancy Zone Protein elisa. Alternative names of the recognized antigen: CPAMD6
  • C3 and PZP-like alpha-2-macroglobulin domain-containing protein 6
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Pregnancy Zone Protein (PZP) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Rat Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Rat Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Rat Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Rat Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Rat Pregnancy Zone Protein (PZP) ELISA Kit
4-SEG324Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Pregnancy Zone Protein elisa. Alternative names of the recognized antigen: CPAMD6
  • C3 and PZP-like alpha-2-macroglobulin domain-containing protein 6
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Pregnancy Zone Protein (PZP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
PZP 3'UTR Luciferase Stable Cell Line
TU019303 1.0 ml
EUR 1394
Pzp 3'UTR Luciferase Stable Cell Line
TU117359 1.0 ml Ask for price
PZP 3'UTR GFP Stable Cell Line
TU069303 1.0 ml
EUR 1394
Pzp 3'UTR GFP Stable Cell Line
TU267147 1.0 ml Ask for price
Pzp 3'UTR Luciferase Stable Cell Line
TU217147 1.0 ml Ask for price
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

PZP Rabbit Polyclonal Antibody