GPC2 Rabbit Polyclonal Antibody

GPC2 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

GPC2 Polyclonal Antibody

ABP58679-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human GPC2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GPC2 from Human. This GPC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPC2 protein

GPC2 Polyclonal Antibody

ABP58679-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GPC2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GPC2 from Human. This GPC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPC2 protein

GPC2 Polyclonal Antibody

ABP58679-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GPC2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GPC2 from Human. This GPC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPC2 protein

Human Glypican 2 (GPC2) ELISA Kit

DLR-GPC2-Hu-48T 48T
EUR 498
  • Should the Human Glypican 2 (GPC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glypican 2 (GPC2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glypican 2 (GPC2) ELISA Kit

DLR-GPC2-Hu-96T 96T
EUR 647
  • Should the Human Glypican 2 (GPC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glypican 2 (GPC2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glypican 2 (GPC2) ELISA Kit

RD-GPC2-Hu-48Tests 48 Tests
EUR 500

Human Glypican 2 (GPC2) ELISA Kit

RD-GPC2-Hu-96Tests 96 Tests
EUR 692

Human Glypican 2 (GPC2) ELISA Kit

RDR-GPC2-Hu-48Tests 48 Tests
EUR 522

Human Glypican 2 (GPC2) ELISA Kit

RDR-GPC2-Hu-96Tests 96 Tests
EUR 724

GPC2 Antibody

47512-100ul 100ul
EUR 252

Rabbit GPC2 ELISA Kit

ERTG0234 96Tests
EUR 521

Polyclonal GPC2 Antibody (N-term)

APR16461G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPC2 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal GPC2 Antibody - C-terminal region

APR16462G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPC2 - C-terminal region. This antibody is tested and proven to work in the following applications:

GPC2 Conjugated Antibody

C47512 100ul
EUR 397

Anti-GPC2 antibody

STJ192101 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GPC2

Anti-GPC2 Antibody

STJ193197 200 µl
EUR 197

Gpc2/ Rat Gpc2 ELISA Kit

ELI-04913r 96 Tests
EUR 886

GPC2 siRNA

20-abx902253
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPC2 siRNA

20-abx918352
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPC2 siRNA

20-abx918353
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Rabbit Glypican 2 (GPC2) ELISA Kit

abx363696-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Glypican 2 (GPC2) Antibody

abx028841-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Glypican 2 (GPC2) Antibody

abx028841-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Glypican 2 (GPC2) Antibody

20-abx172654
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Glypican 2 (GPC2) Antibody

20-abx176682
  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.

GPC2 cloning plasmid

CSB-CL818680HU-10ug 10ug
EUR 597
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1740
  • Sequence: atgtccgcgctgcgacctctcctgcttctgctgctgcctctgtgtcccggtcctggtcccggacccgggagcgaggcaaaggtcacccggagttgtgcagagacccggcaggtgctgggggcccggggatatagcttaaacctaatccctcccgccctgatctcaggtgagcacc
  • Show more
Description: A cloning plasmid for the GPC2 gene.

GPC2 Rabbit Polyclonal Antibody