FOXC2 Rabbit Polyclonal Antibody

FOXC2 Rabbit Polyclonal Antibody

To Order Now: info@crossfiredatabases.com

FOXC2 Polyclonal Antibody
ABP58584-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human FOXC2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FOXC2 from Human, Mouse, Rat. This FOXC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FOXC2 protein

FOXC2 Polyclonal Antibody
ABP58584-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FOXC2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FOXC2 from Human, Mouse, Rat. This FOXC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FOXC2 protein

FOXC2 Polyclonal Antibody
ABP58584-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FOXC2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FOXC2 from Human, Mouse, Rat. This FOXC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FOXC2 protein

FOXC2 Antibody
36862-100ul 100ul
EUR 252

FOXC2 Antibody
1-CSB-PA955638
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FOXC2. Recognizes FOXC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

FOXC2 Antibody
1-CSB-PA975779
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FOXC2. Recognizes FOXC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

FOXC2 Antibody
1-CSB-PA857880LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FOXC2. Recognizes FOXC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Rabbit FoxC2 ELISA Kit
ERTF0027 96Tests
EUR 521

Polyclonal Goat Anti-FOXC2 Antibody
AMM04978G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-FOXC2 . This antibody is tested and proven to work in the following applications:

Polyclonal Foxc2 antibody - N-terminal region
APR00773G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Foxc2 - N-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal FOXC2 antibody - C-terminal region
AMM04599G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FOXC2 - C-terminal region. This antibody is tested and proven to work in the following applications:

FOXC2 Conjugated Antibody
C36862 100ul
EUR 397

anti- FOXC2 antibody
FNab03191 100µg
EUR 505.25
  • Immunogen: forkhead box C2(MFH-1, mesenchyme forkhead 1)
  • Uniprot ID: Q99958
  • Gene ID: 2303
  • Research Area: Epigenetics, Signal Transduction, Metabolism, Developmental biology, Neuroscience
Description: Antibody raised against FOXC2

FOXC1 / FOXC2 Antibody
20-abx329537
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

FOXC1/FOXC2 Antibody
1-CSB-PA008290
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FOXC1/FOXC2. Recognizes FOXC1/FOXC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

Anti-FOXC2 antibody
PAab03191 100 ug
EUR 355

Anti-FOXC2 antibody
STJ70385 100 µg
EUR 359

Anti-FOXC2 antibody
STJ192155 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FOXC2

Foxc2/ Rat Foxc2 ELISA Kit
ELI-30871r 96 Tests
EUR 886

FOXC2 siRNA
20-abx902004
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FOXC2 siRNA
20-abx917093
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FOXC2 siRNA
20-abx917094
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FOXC2 Antibody, HRP conjugated
1-CSB-PA857880LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FOXC2. Recognizes FOXC2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FOXC2 Antibody, FITC conjugated
1-CSB-PA857880LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FOXC2. Recognizes FOXC2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FOXC2 Antibody, Biotin conjugated
1-CSB-PA857880LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FOXC2. Recognizes FOXC2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Goat Anti Human Foxc2 (C-Terminal) Polyclonal Antibody
CPBT-67491GH 0.1 mg
EUR 840

FOXC2 cloning plasmid
CSB-CL857880HU-10ug 10ug
EUR 531
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1506
  • Sequence: ATGCAGGCGCGCTACTCCGTGTCCGACCCCAACGCCCTGGGAGTGGTGCCCTACCTGAGCGAGCAGAATTACTACCGGGCTGCGGGCAGCTACGGCGGCATGGCCAGCCCCATGGGCGTCTATTCCGGCCACCCGGAGCAGTACAGCGCGGGGATGGGCCGCTCCTACGCGCCCT
  • Show more
Description: A cloning plasmid for the FOXC2 gene.

Anti-FOXC2 (3H3)
YF-MA13050 100 ug
EUR 363
Description: Mouse monoclonal to FOXC2

Anti-FOXC2 (3H3)
YF-MA13051 200 ul
EUR 363
Description: Mouse monoclonal to FOXC2

Anti-FOXC2 (2H3)
YF-MA13052 200 ul
EUR 363
Description: Mouse monoclonal to FOXC2

Anti-FOXC2 (4B3)
YF-MA13053 100 ug
EUR 363
Description: Mouse monoclonal to FOXC2

Anti-FOXC2 (1A8)
YF-MA13054 100 ug
EUR 363
Description: Mouse monoclonal to FOXC2

Anti-FOXC2 (3H5)
YF-MA13055 100 ug
EUR 363
Description: Mouse monoclonal to FOXC2

Anti-FOXC2 (3E6)
YF-MA13056 100 ug
EUR 363
Description: Mouse monoclonal to FOXC2

Anti-FOXC2 (4A5)
YF-MA13057 100 ug
EUR 363
Description: Mouse monoclonal to FOXC2

Anti-FOXC2 (4A3)
YF-MA13058 100 ug
EUR 363
Description: Mouse monoclonal to FOXC2

Anti-FOXC2 (1D4)
YF-MA13059 100 ug
EUR 363
Description: Mouse monoclonal to FOXC2

Anti-FOXC2 (3D6)
YF-MA20189 100 ug
EUR 363
Description: Mouse monoclonal to FOXC2

Monoclonal FOXC2 Antibody, Clone: 1D11C8
AMM04595G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human FOXC2. The antibodies are raised in Mouse and are from clone 1D11C8. This antibody is applicable in WB, E

Monoclonal FOXC2 Antibody, Clone: 1D11C8
AMM04596G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human FOXC2. The antibodies are raised in Mouse and are from clone 1D11C8. This antibody is applicable in WB, E

Forkhead Box Protein C2 (FOXC2) Antibody
abx015862-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Forkhead Box Protein C2 (FOXC2) Antibody
abx015863-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Forkhead Box Protein C2 (FOXC2) Antibody
abx431254-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Forkhead Box Protein C2 (FOXC2) Antibody
20-abx242341
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Forkhead Box Protein C2 (FOXC2) Antibody
20-abx242342
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Forkhead Box Protein C2 (FOXC2) Antibody
20-abx301856
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Forkhead Box Protein C2 (FOXC2) Antibody
abx233191-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Rat FOXC2 shRNA Plasmid
20-abx987740
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FoxC2 ELISA Kit
EHF0027 96Tests
EUR 521

Human FOXC2 ELISA Kit
ELA-E12449h 96 Tests
EUR 824

Goat FoxC2 ELISA Kit
EGTF0027 96Tests
EUR 521

Canine FoxC2 ELISA Kit
ECF0027 96Tests
EUR 521

Bovine FoxC2 ELISA Kit
EBF0027 96Tests
EUR 521

Anserini FoxC2 ELISA Kit
EAF0027 96Tests
EUR 521

FOXC2 ELISA KIT|Human
EF004777 96 Tests
EUR 689

Porcine FoxC2 ELISA Kit
EPF0027 96Tests
EUR 521

Rat FoxC2 ELISA Kit
ERF0027 96Tests
EUR 521

Mouse FoxC2 ELISA Kit
EMF0027 96Tests
EUR 521

Mouse FOXC2 shRNA Plasmid
20-abx970357
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FOXC2 shRNA Plasmid
20-abx951610
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FOXC2 Recombinant Protein (Human)
RP039259 100 ug Ask for price

pCR4-TOPO-foxc2 Plasmid
PVTB00241S 2 ug
EUR 356

FOXC2 Recombinant Protein (Rat)
RP201671 100 ug Ask for price

FOXC2 Recombinant Protein (Mouse)
RP135026 100 ug Ask for price

Monoclonal FOXC2 Antibody (monoclonal) (M02), Clone: 2H3
AMM04597G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human FOXC2 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 2H3. This antibody is applicable in WB, IHC and IF, E

Monoclonal FOXC2 Antibody (monoclonal) (M03), Clone: 4B3
AMM04598G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human FOXC2 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 4B3. This antibody is applicable in WB, E

Forkhead Box Protein C2 (FOXC2) Antibody (HRP)
20-abx316492
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Forkhead Box Protein C2 (FOXC2) Antibody (FITC)
20-abx316493
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Forkhead Box Protein C2 (FOXC2) Antibody (Biotin)
20-abx316494
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Guinea Pig FoxC2 ELISA Kit
EGF0027 96Tests
EUR 521

Foxc2 ORF Vector (Rat) (pORF)
ORF067225 1.0 ug DNA
EUR 506

Foxc2 ORF Vector (Mouse) (pORF)
ORF045010 1.0 ug DNA
EUR 506

FOXC2 ORF Vector (Human) (pORF)
ORF013087 1.0 ug DNA
EUR 95

Human Forkhead box C2（FOXC2）
QY-E05307 96T
EUR 394

FOXC2 ELISA Kit (Mouse) (OKEH05599)
OKEH05599 96 Wells
EUR 779
Description: Description of target: Transcriptional activator. Might be involved in the formation of special mesenchymal tissues.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.09 ng/mL

FOXC2 sgRNA CRISPR Lentivector set (Human)
K0795201 3 x 1.0 ug
EUR 339

Foxc2 sgRNA CRISPR Lentivector set (Mouse)
K5011901 3 x 1.0 ug
EUR 339

Foxc2 sgRNA CRISPR Lentivector set (Rat)
K7110801 3 x 1.0 ug
EUR 339

FOXC2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0795202 1.0 ug DNA
EUR 154

FOXC2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0795203 1.0 ug DNA
EUR 154

FOXC2 Rabbit Polyclonal Antibody

Apex Business WordPress Theme | Designed by Crafthemes